Incidental Mutation 'R6544:Gigyf1'
ID 521010
Institutional Source Beutler Lab
Gene Symbol Gigyf1
Ensembl Gene ENSMUSG00000029714
Gene Name GRB10 interacting GYF protein 1
Synonyms Perq1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R6544 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 137518548-137527935 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137525059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 911 (L911Q)
Ref Sequence ENSEMBL: ENSMUSP00000031727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031726] [ENSMUST00000031727] [ENSMUST00000111020] [ENSMUST00000111023] [ENSMUST00000111027] [ENSMUST00000111038] [ENSMUST00000132525] [ENSMUST00000140139] [ENSMUST00000143495] [ENSMUST00000168746] [ENSMUST00000170293] [ENSMUST00000150063] [ENSMUST00000197624]
AlphaFold Q99MR1
Predicted Effect probably benign
Transcript: ENSMUST00000031726
SMART Domains Protein: ENSMUSP00000031726
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000031727
AA Change: L911Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031727
Gene: ENSMUSG00000029714
AA Change: L911Q

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 323 352 N/A INTRINSIC
low complexity region 360 379 N/A INTRINSIC
coiled coil region 424 450 N/A INTRINSIC
GYF 477 532 1.6e-25 SMART
low complexity region 534 543 N/A INTRINSIC
low complexity region 553 576 N/A INTRINSIC
low complexity region 597 613 N/A INTRINSIC
coiled coil region 671 735 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
low complexity region 848 877 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
coiled coil region 957 984 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111020
SMART Domains Protein: ENSMUSP00000106649
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111023
SMART Domains Protein: ENSMUSP00000106652
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111027
SMART Domains Protein: ENSMUSP00000106656
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 45 59 N/A INTRINSIC
WD40 86 125 1.05e-7 SMART
WD40 128 167 3.96e-3 SMART
WD40 174 212 1.57e-6 SMART
WD40 215 254 2.98e-7 SMART
WD40 257 296 2.1e-7 SMART
WD40 299 340 1.72e-3 SMART
WD40 343 382 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111038
SMART Domains Protein: ENSMUSP00000106667
Gene: ENSMUSG00000029711

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EPO_TPO 30 191 2.8e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125868
Predicted Effect probably benign
Transcript: ENSMUST00000132525
SMART Domains Protein: ENSMUSP00000119725
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140139
SMART Domains Protein: ENSMUSP00000121942
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142252
Predicted Effect probably benign
Transcript: ENSMUST00000143495
SMART Domains Protein: ENSMUSP00000126823
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145238
Predicted Effect probably benign
Transcript: ENSMUST00000168746
SMART Domains Protein: ENSMUSP00000132908
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185075
Predicted Effect probably benign
Transcript: ENSMUST00000170293
SMART Domains Protein: ENSMUSP00000128038
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150063
SMART Domains Protein: ENSMUSP00000129353
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167225
Predicted Effect probably benign
Transcript: ENSMUST00000197624
SMART Domains Protein: ENSMUSP00000143670
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Gigyf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gigyf1 APN 5 137522745 unclassified probably benign
IGL00326:Gigyf1 APN 5 137518948 utr 5 prime probably benign
IGL00935:Gigyf1 APN 5 137524834 missense possibly damaging 0.95
IGL01717:Gigyf1 APN 5 137525691 missense probably damaging 1.00
IGL02090:Gigyf1 APN 5 137525564 splice site probably null
IGL02354:Gigyf1 APN 5 137519727 splice site probably benign
IGL02361:Gigyf1 APN 5 137519727 splice site probably benign
IGL03370:Gigyf1 APN 5 137525690 missense possibly damaging 0.93
PIT4354001:Gigyf1 UTSW 5 137524104 missense unknown
R1415:Gigyf1 UTSW 5 137519216 splice site probably null
R1764:Gigyf1 UTSW 5 137522508 unclassified probably benign
R2259:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R2260:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R4656:Gigyf1 UTSW 5 137525215 nonsense probably null
R4717:Gigyf1 UTSW 5 137525232 missense probably damaging 1.00
R4732:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4733:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4942:Gigyf1 UTSW 5 137525690 missense possibly damaging 0.93
R5338:Gigyf1 UTSW 5 137523160 unclassified probably benign
R5503:Gigyf1 UTSW 5 137523467 unclassified probably benign
R5790:Gigyf1 UTSW 5 137524255 unclassified probably benign
R5888:Gigyf1 UTSW 5 137525697 missense probably damaging 1.00
R5955:Gigyf1 UTSW 5 137523507 splice site probably null
R7227:Gigyf1 UTSW 5 137523823 missense unknown
R7493:Gigyf1 UTSW 5 137525533 missense probably damaging 0.98
R7660:Gigyf1 UTSW 5 137520969 missense probably benign 0.23
R7959:Gigyf1 UTSW 5 137524319 missense probably damaging 1.00
R8026:Gigyf1 UTSW 5 137525478 missense probably damaging 1.00
R8159:Gigyf1 UTSW 5 137522195 missense unknown
R8552:Gigyf1 UTSW 5 137523139 unclassified probably benign
R8936:Gigyf1 UTSW 5 137525207 missense probably damaging 0.99
R9622:Gigyf1 UTSW 5 137524664 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGCTAAGGTCTGGGCTTATC -3'
(R):5'- CCGCTCCAGGAATTGTTTGG -3'

Sequencing Primer
(F):5'- GGGCTTATCTGTGGCCTCC -3'
(R):5'- GCTCCAGGAATTGTTTGGCAAATTC -3'
Posted On 2018-06-06