Incidental Mutation 'R6519:Wwc1'
ID521018
Institutional Source Beutler Lab
Gene Symbol Wwc1
Ensembl Gene ENSMUSG00000018849
Gene NameWW, C2 and coiled-coil domain containing 1
SynonymsKibra
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_170779.1; MGI: 2388637

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location35838400-35980527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35853437 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 853 (E853K)
Ref Sequence ENSEMBL: ENSMUSP00000018993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018993]
Predicted Effect probably benign
Transcript: ENSMUST00000018993
AA Change: E853K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018993
Gene: ENSMUSG00000018849
AA Change: E853K

DomainStartEndE-ValueType
WW 7 39 7.96e-12 SMART
WW 54 86 5.22e-7 SMART
coiled coil region 107 133 N/A INTRINSIC
low complexity region 139 153 N/A INTRINSIC
coiled coil region 158 193 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
coiled coil region 294 330 N/A INTRINSIC
low complexity region 341 353 N/A INTRINSIC
coiled coil region 360 431 N/A INTRINSIC
low complexity region 527 549 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
Pfam:C2 674 784 8.3e-7 PFAM
low complexity region 842 860 N/A INTRINSIC
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131001
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype Strain: 5301655
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adult synaptic plasticity and fear-based conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Wwc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Wwc1 APN 11 35844202 missense possibly damaging 0.82
IGL01161:Wwc1 APN 11 35867276 missense probably damaging 1.00
IGL01401:Wwc1 APN 11 35898618 critical splice donor site probably null
IGL01771:Wwc1 APN 11 35853358 critical splice donor site probably null
IGL01804:Wwc1 APN 11 35841924 missense probably damaging 1.00
IGL02079:Wwc1 APN 11 35876058 missense probably damaging 1.00
IGL02201:Wwc1 APN 11 35844151 splice site probably benign
IGL03376:Wwc1 APN 11 35852294 missense possibly damaging 0.80
IGL03403:Wwc1 APN 11 35915284 missense possibly damaging 0.94
BB002:Wwc1 UTSW 11 35844163 missense probably benign 0.00
BB012:Wwc1 UTSW 11 35844163 missense probably benign 0.00
P0008:Wwc1 UTSW 11 35853351 splice site probably benign
R0277:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0321:Wwc1 UTSW 11 35841810 nonsense probably null
R0323:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0629:Wwc1 UTSW 11 35853472 missense probably benign 0.18
R1302:Wwc1 UTSW 11 35844157 missense probably damaging 1.00
R1769:Wwc1 UTSW 11 35861844 missense probably benign
R1870:Wwc1 UTSW 11 35861945 missense probably damaging 1.00
R2000:Wwc1 UTSW 11 35876547 missense probably damaging 1.00
R2074:Wwc1 UTSW 11 35889353 missense possibly damaging 0.62
R2138:Wwc1 UTSW 11 35841887 missense possibly damaging 0.47
R2140:Wwc1 UTSW 11 35870528 missense probably benign 0.01
R2680:Wwc1 UTSW 11 35875929 missense probably benign 0.23
R3864:Wwc1 UTSW 11 35910316 missense probably damaging 1.00
R4773:Wwc1 UTSW 11 35867296 missense probably benign
R4926:Wwc1 UTSW 11 35889400 missense probably benign 0.17
R4980:Wwc1 UTSW 11 35888103 missense possibly damaging 0.93
R4990:Wwc1 UTSW 11 35876566 missense probably benign 0.00
R5044:Wwc1 UTSW 11 35883345 missense probably benign 0.45
R5238:Wwc1 UTSW 11 35875896 missense probably benign 0.02
R5421:Wwc1 UTSW 11 35876063 missense possibly damaging 0.81
R5421:Wwc1 UTSW 11 35910296 missense possibly damaging 0.93
R5461:Wwc1 UTSW 11 35867372 missense probably damaging 1.00
R5705:Wwc1 UTSW 11 35876596 missense probably damaging 0.99
R5847:Wwc1 UTSW 11 35867326 missense probably damaging 1.00
R5993:Wwc1 UTSW 11 35852336 missense probably benign 0.17
R6006:Wwc1 UTSW 11 35870982 missense probably null 1.00
R6006:Wwc1 UTSW 11 35889273 missense probably damaging 0.98
R6516:Wwc1 UTSW 11 35867302 missense probably benign 0.05
R6520:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6525:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6526:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6527:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6528:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R7060:Wwc1 UTSW 11 35915176 missense possibly damaging 0.74
R7156:Wwc1 UTSW 11 35897374 critical splice donor site probably null
R7448:Wwc1 UTSW 11 35875706 missense probably benign
R7586:Wwc1 UTSW 11 35844195 missense possibly damaging 0.69
R7793:Wwc1 UTSW 11 35869109 missense probably benign 0.21
R7925:Wwc1 UTSW 11 35844163 missense probably benign 0.00
R8296:Wwc1 UTSW 11 35870557 splice site probably benign
R8369:Wwc1 UTSW 11 35867371 missense probably damaging 1.00
R8735:Wwc1 UTSW 11 35883407 missense probably damaging 1.00
R8804:Wwc1 UTSW 11 35883317 missense probably benign 0.30
X0025:Wwc1 UTSW 11 35876040 missense possibly damaging 0.95
Z1088:Wwc1 UTSW 11 35883482 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCCACTTCTGAGCACAGTG -3'
(R):5'- GATGCACGCATTCAGACAAG -3'

Sequencing Primer
(F):5'- TTCTGAGCACAGTGCCCAC -3'
(R):5'- CAGCCGCATATTGAAGGTTC -3'
Posted On2018-06-06