Incidental Mutation 'R6544:Tpte'
ID 521021
Institutional Source Beutler Lab
Gene Symbol Tpte
Ensembl Gene ENSMUSG00000031481
Gene Name transmembrane phosphatase with tensin homology
Synonyms Pten2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6544 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 22283441-22371418 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 22315105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077194] [ENSMUST00000211497] [ENSMUST00000211747]
AlphaFold G5E8H5
Predicted Effect probably null
Transcript: ENSMUST00000077194
SMART Domains Protein: ENSMUSP00000076435
Gene: ENSMUSG00000031481

DomainStartEndE-ValueType
low complexity region 146 167 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 246 265 N/A INTRINSIC
transmembrane domain 277 299 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Pfam:Y_phosphatase 369 511 1.4e-6 PFAM
Pfam:DSPc 384 505 7.3e-8 PFAM
PTEN_C2 529 663 3.72e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211497
Predicted Effect probably benign
Transcript: ENSMUST00000211747
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Tpte
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Tpte APN 8 22320882 missense probably benign 0.03
IGL01456:Tpte APN 8 22345052 splice site probably benign
IGL01947:Tpte APN 8 22355473 missense possibly damaging 0.88
IGL01975:Tpte APN 8 22349337 missense probably damaging 1.00
IGL02458:Tpte APN 8 22305858 missense probably benign
IGL03411:Tpte APN 8 22325537 missense possibly damaging 0.64
R0158:Tpte UTSW 8 22327739 missense possibly damaging 0.47
R0396:Tpte UTSW 8 22335608 splice site probably benign
R0611:Tpte UTSW 8 22336533 missense possibly damaging 0.68
R1481:Tpte UTSW 8 22355471 missense probably damaging 1.00
R1489:Tpte UTSW 8 22349389 critical splice donor site probably null
R1569:Tpte UTSW 8 22345031 missense probably damaging 0.98
R1632:Tpte UTSW 8 22349347 missense probably damaging 0.98
R1639:Tpte UTSW 8 22320897 missense probably benign 0.00
R2030:Tpte UTSW 8 22345885 missense probably damaging 1.00
R2057:Tpte UTSW 8 22318339 missense probably benign 0.13
R2519:Tpte UTSW 8 22333160 splice site probably benign
R2655:Tpte UTSW 8 22311278 critical splice acceptor site probably null
R2884:Tpte UTSW 8 22335423 nonsense probably null
R3033:Tpte UTSW 8 22320872 missense possibly damaging 0.84
R3734:Tpte UTSW 8 22359482 missense probably damaging 1.00
R3961:Tpte UTSW 8 22359415 missense probably damaging 0.99
R4050:Tpte UTSW 8 22365984 missense probably damaging 1.00
R4591:Tpte UTSW 8 22327775 missense probably benign 0.08
R4994:Tpte UTSW 8 22318346 missense probably benign 0.23
R5321:Tpte UTSW 8 22297203 nonsense probably null
R5394:Tpte UTSW 8 22327790 missense probably damaging 1.00
R5588:Tpte UTSW 8 22284967 missense possibly damaging 0.95
R5590:Tpte UTSW 8 22351452 missense probably damaging 1.00
R5670:Tpte UTSW 8 22327748 missense probably damaging 1.00
R6596:Tpte UTSW 8 22333269 missense probably damaging 0.99
R6729:Tpte UTSW 8 22355475 missense probably damaging 1.00
R7120:Tpte UTSW 8 22327673 missense probably damaging 1.00
R7526:Tpte UTSW 8 22325547 critical splice donor site probably null
R7575:Tpte UTSW 8 22355482 missense probably damaging 1.00
R9099:Tpte UTSW 8 22355481 missense
R9248:Tpte UTSW 8 22351473 missense possibly damaging 0.95
R9393:Tpte UTSW 8 22284974 missense probably benign
RF006:Tpte UTSW 8 22306943 missense probably benign
Z1176:Tpte UTSW 8 22333193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCAAATGTTAGCCAGTC -3'
(R):5'- GACCATGTCTACAATTCTCCACG -3'

Sequencing Primer
(F):5'- GTGTGCAAATGTTAGCCAGTCTATAG -3'
(R):5'- GCCCCTGTGTATAAGGTTACATCTG -3'
Posted On 2018-06-06