Incidental Mutation 'R6519:Rdh11'
ID521022
Institutional Source Beutler Lab
Gene Symbol Rdh11
Ensembl Gene ENSMUSG00000066441
Gene Nameretinol dehydrogenase 11
SynonymsArsdr1, Mdt1, Psdr1, 2610319N22Rik, M42C60
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location79174337-79192293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79182815 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 228 (H228L)
Ref Sequence ENSEMBL: ENSMUSP00000124066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085254] [ENSMUST00000159500] [ENSMUST00000161204]
Predicted Effect probably damaging
Transcript: ENSMUST00000085254
AA Change: H212L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082352
Gene: ENSMUSG00000066441
AA Change: H212L

DomainStartEndE-ValueType
Pfam:adh_short 23 201 1.3e-23 PFAM
Pfam:KR 24 190 1.6e-10 PFAM
Pfam:Epimerase 25 227 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159500
Predicted Effect probably damaging
Transcript: ENSMUST00000161204
AA Change: H228L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124066
Gene: ENSMUSG00000066441
AA Change: H228L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:adh_short 39 244 1.7e-36 PFAM
Pfam:KR 40 199 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an NADPH-dependent retinal reductase and a short-chain dehydrogenase/reductase. The encoded protein has no steroid dehydrogenase activity. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit delayed dark adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Rdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Rdh11 APN 12 79186413 critical splice donor site probably null
IGL02642:Rdh11 APN 12 79185336 splice site probably benign
IGL02867:Rdh11 APN 12 79189054 missense possibly damaging 0.64
R2085:Rdh11 UTSW 12 79182782 missense possibly damaging 0.87
R2115:Rdh11 UTSW 12 79176222 missense probably benign
R4963:Rdh11 UTSW 12 79188606 missense probably benign 0.31
R5458:Rdh11 UTSW 12 79188505 missense probably benign 0.11
R6090:Rdh11 UTSW 12 79189064 missense probably benign 0.05
R7586:Rdh11 UTSW 12 79185183 missense probably damaging 1.00
R8219:Rdh11 UTSW 12 79189106 missense probably benign 0.05
R8719:Rdh11 UTSW 12 79182800 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCCTCATACCTGAAATGACTGC -3'
(R):5'- AAGCCTGTCTCTTAGGAGCC -3'

Sequencing Primer
(F):5'- TACCTGAAATGACTGCCACTTAGG -3'
(R):5'- CTGCAGCGTGTATAAATTGCAG -3'
Posted On2018-06-06