Mutagenetix > Incidental Mutations

Incidental Mutation 'R6544:Adam26b'

521023

Institutional Source

Beutler Lab

Gene Symbol

Adam26b

Ensembl Gene

ENSMUSG00000063900

Gene Name

a disintegrin and metallopeptidase domain 26B

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R6544 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43519762-43528106 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43521781 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 61 (I61M)

Ref Sequence

ENSEMBL: ENSMUSP00000079032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080135]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080135
AA Change: I61M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: I61M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	29	147	4.9e-18	PFAM
Pfam:Reprolysin_5	193	364	4.8e-15	PFAM
Pfam:Reprolysin_4	194	380	1.3e-8	PFAM
Pfam:Reprolysin	195	385	9.9e-50	PFAM
Pfam:Reprolysin_2	215	377	3.9e-15	PFAM
Pfam:Reprolysin_3	219	340	2e-15	PFAM
DISIN	401	476	5.88e-40	SMART
ACR	477	613	7.69e-64	SMART
low complexity region	631	642	N/A	INTRINSIC
transmembrane domain	670	692	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (48/48)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A030005K14Rik	T	A	1: 83,058,957	K118*	probably null	Het
Actr2	A	G	11: 20,100,933	F17L	probably damaging	Het
Ahnak2	A	G	12: 112,780,652		probably benign	Het
Angptl3	T	C	4: 99,031,438	L145P	probably damaging	Het
Ank2	T	C	3: 126,933,222	T808A	probably damaging	Het
Cadm3	A	G	1: 173,367,411		probably null	Het
Cog7	C	T	7: 121,935,743	R573Q	probably damaging	Het
Dchs1	T	A	7: 105,758,178	I2110F	probably damaging	Het
Fbxo47	G	A	11: 97,856,263	R326C	probably damaging	Het
Frmpd1	A	T	4: 45,279,024	D583V	probably damaging	Het
Gigyf1	T	A	5: 137,525,059	L911Q	probably damaging	Het
Gm35339	T	C	15: 76,358,278	Y823H	probably benign	Het
Gm4737	A	C	16: 46,154,784	S77A	probably benign	Het
Gprin1	G	A	13: 54,740,311	A50V	possibly damaging	Het
Grik4	A	T	9: 42,547,728	Y571*	probably null	Het
Gucy2e	A	G	11: 69,235,657	V299A	probably benign	Het
Hectd2	C	T	19: 36,612,328	L618F	probably damaging	Het
Lactbl1	A	T	4: 136,632,989	I160F	possibly damaging	Het
Lats1	T	A	10: 7,701,670	V186D	possibly damaging	Het
Lmtk2	A	G	5: 144,173,806	H448R	possibly damaging	Het
Map10	T	C	8: 125,671,374	I502T	probably benign	Het
Mok	A	G	12: 110,810,755	F239S	probably damaging	Het
Mprip	G	A	11: 59,757,726	G752D	probably benign	Het
Naip5	C	A	13: 100,223,144	G528V	possibly damaging	Het
Neu2	T	C	1: 87,596,742	W150R	probably damaging	Het
Olfr1111	T	A	2: 87,149,863	Y266F	probably damaging	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr1434	T	C	19: 12,283,155	Y36H	probably damaging	Het
Olfr356	T	A	2: 36,937,527	M136K	possibly damaging	Het
Pip5k1c	T	A	10: 81,308,996	Y224N	probably damaging	Het
Plch1	T	C	3: 63,850,978	E5G	probably damaging	Het
Pspc1	T	C	14: 56,764,203	*59W	probably null	Het
Ptprq	T	C	10: 107,608,241	T1501A	probably damaging	Het
Rnf165	T	A	18: 77,563,235		probably benign	Het
Rorb	G	T	19: 18,952,250	P304T	possibly damaging	Het
Scn7a	A	T	2: 66,684,100	L1110Q	probably damaging	Het
Serpine2	C	T	1: 79,803,130		probably null	Het
Slco1c1	A	G	6: 141,531,444		probably null	Het
Smarca2	T	A	19: 26,630,931	V130D	probably damaging	Het
Sox17	G	T	1: 4,492,432	P117T	possibly damaging	Het
Sparcl1	A	T	5: 104,092,444	Y371*	probably null	Het
Tdpoz2	T	C	3: 93,651,960	D235G	possibly damaging	Het
Tns2	A	C	15: 102,113,834	K1182N	possibly damaging	Het
Tpte	G	T	8: 22,315,105		probably null	Het
Ttn	A	T	2: 76,969,159	I459K	possibly damaging	Het
Zc3h15	G	A	2: 83,661,148	R240H	probably benign	Het
Zfp455	C	A	13: 67,207,057	L130I	probably benign	Het
Zfp777	A	T	6: 48,044,485	S68T	probably damaging	Het

Other mutations in Adam26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Adam26b	APN	8	43520179	missense	probably damaging	1.00
IGL00806:Adam26b	APN	8	43521342	missense	probably damaging	1.00
IGL00984:Adam26b	APN	8	43520373	missense	possibly damaging	0.86
IGL01081:Adam26b	APN	8	43519938	missense	probably benign	0.00
IGL01783:Adam26b	APN	8	43521761	missense	probably benign	0.30
IGL02021:Adam26b	APN	8	43519872	missense	probably benign
IGL02707:Adam26b	APN	8	43519858	utr 3 prime	probably benign
IGL03112:Adam26b	APN	8	43521512	missense	probably benign
R0195:Adam26b	UTSW	8	43520270	missense	probably damaging	0.99
R0453:Adam26b	UTSW	8	43520350	missense	probably benign	0.00
R0562:Adam26b	UTSW	8	43520371	missense	probably benign	0.36
R0645:Adam26b	UTSW	8	43520487	missense	probably damaging	1.00
R0763:Adam26b	UTSW	8	43520564	missense	probably damaging	1.00
R1697:Adam26b	UTSW	8	43520963	missense	probably damaging	0.98
R1739:Adam26b	UTSW	8	43521677	missense	probably damaging	1.00
R1751:Adam26b	UTSW	8	43519911	missense	probably benign	0.00
R1767:Adam26b	UTSW	8	43519911	missense	probably benign	0.00
R1994:Adam26b	UTSW	8	43520639	missense	probably benign	0.44
R3747:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3748:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3750:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3771:Adam26b	UTSW	8	43520714	missense	probably damaging	1.00
R4027:Adam26b	UTSW	8	43520372	missense	probably benign	0.09
R4652:Adam26b	UTSW	8	43521338	missense	possibly damaging	0.49
R4790:Adam26b	UTSW	8	43520727	missense	probably benign	0.19
R4859:Adam26b	UTSW	8	43520259	missense	possibly damaging	0.80
R5059:Adam26b	UTSW	8	43520600	missense	probably damaging	1.00
R5191:Adam26b	UTSW	8	43519991	missense	probably damaging	1.00
R5540:Adam26b	UTSW	8	43521617	missense	probably damaging	1.00
R5568:Adam26b	UTSW	8	43520492	missense	probably benign	0.00
R5886:Adam26b	UTSW	8	43520273	missense	possibly damaging	0.72
R5935:Adam26b	UTSW	8	43521298	missense	probably benign	0.00
R5983:Adam26b	UTSW	8	43521341	missense	probably damaging	1.00
R6610:Adam26b	UTSW	8	43521153	missense	probably damaging	1.00
R6668:Adam26b	UTSW	8	43520690	missense	possibly damaging	0.72
R6966:Adam26b	UTSW	8	43521435	missense	possibly damaging	0.51
R7545:Adam26b	UTSW	8	43521713	missense	probably damaging	0.98
R7596:Adam26b	UTSW	8	43520200	missense	probably benign
R7634:Adam26b	UTSW	8	43520997	missense	probably benign
R7657:Adam26b	UTSW	8	43521542	missense	possibly damaging	0.95
R7692:Adam26b	UTSW	8	43520795	missense	probably benign	0.00
R7769:Adam26b	UTSW	8	43521695	missense	probably benign	0.00
R7912:Adam26b	UTSW	8	43520208	missense	probably benign	0.13
R7993:Adam26b	UTSW	8	43520208	missense	probably benign	0.13
X0066:Adam26b	UTSW	8	43520004	missense	probably damaging	0.97
Z1088:Adam26b	UTSW	8	43520597	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCTAGTGTGCCTTGCAAGC -3'
(R):5'- CTAAGGTCCTGGTCCATAAAAGG -3'

Sequencing Primer
(F):5'- GCTCCCAAAACAGGTGTTG -3'
(R):5'- GAACATGTTCCTTAAGTTCTGCCTG -3'

Posted On

2018-06-06