Incidental Mutation 'R6519:Hus1b'
ID521024
Institutional Source Beutler Lab
Gene Symbol Hus1b
Ensembl Gene ENSMUSG00000076430
Gene NameHUS1 checkpoint clamp component B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location30946573-30947759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30946947 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 243 (I243T)
Ref Sequence ENSEMBL: ENSMUSP00000100007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102943] [ENSMUST00000102946]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102943
AA Change: I243T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100007
Gene: ENSMUSG00000076430
AA Change: I243T

DomainStartEndE-ValueType
Pfam:Hus1 1 276 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223216
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is most closely related to HUS1, a component of a cell cycle checkpoint protein complex involved in cell cycle arrest in response to DNA damage. This protein can interact with the check point protein RAD1 but not with RAD9. Overexpression of this protein has been shown to induce cell death, which suggests a related but distinct role of this protein, as compared to the HUS1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Hus1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Hus1b APN 13 30947544 missense probably benign
IGL02058:Hus1b APN 13 30946917 missense probably benign 0.10
R1104:Hus1b UTSW 13 30947696 intron probably benign
R1476:Hus1b UTSW 13 30947001 missense probably benign 0.10
R3154:Hus1b UTSW 13 30947253 missense probably benign
R4551:Hus1b UTSW 13 30947076 missense probably damaging 1.00
R4583:Hus1b UTSW 13 30947518 missense probably damaging 1.00
R5481:Hus1b UTSW 13 30946959 missense probably benign 0.15
R6416:Hus1b UTSW 13 30947205 missense probably damaging 1.00
R7057:Hus1b UTSW 13 30947550 missense possibly damaging 0.62
R7569:Hus1b UTSW 13 30946864 missense probably damaging 1.00
R8175:Hus1b UTSW 13 30947232 missense probably benign 0.25
Z1177:Hus1b UTSW 13 30946992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAAATCCATGGGGTTGC -3'
(R):5'- GAAGCAAACCTCAATGGCAG -3'

Sequencing Primer
(F):5'- GGTTGCAGGCTTTTAACACAAG -3'
(R):5'- CCTCAATGGCAGAATGAACTTGACTG -3'
Posted On2018-06-06