Incidental Mutation 'R6544:Map10'
ID521025
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Namemicrotubule-associated protein 10
Synonyms4933403G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125669818-125673359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125671374 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 502 (I502T)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
Predicted Effect probably benign
Transcript: ENSMUST00000053078
AA Change: I502T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: I502T

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 125671932 missense probably benign 0.00
IGL01567:Map10 APN 8 125671493 missense probably benign 0.32
IGL02566:Map10 APN 8 125671755 missense probably benign
IGL03088:Map10 APN 8 125671070 missense probably benign 0.14
debauched UTSW 8 125671245 missense probably damaging 1.00
R1083:Map10 UTSW 8 125670439 nonsense probably null
R1543:Map10 UTSW 8 125670872 missense probably benign 0.00
R3155:Map10 UTSW 8 125671574 missense possibly damaging 0.79
R4076:Map10 UTSW 8 125671845 missense probably benign 0.23
R4559:Map10 UTSW 8 125671814 missense probably benign
R4856:Map10 UTSW 8 125670692 missense probably damaging 1.00
R4886:Map10 UTSW 8 125670692 missense probably damaging 1.00
R5412:Map10 UTSW 8 125670985 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6150:Map10 UTSW 8 125671589 missense probably damaging 0.96
R6351:Map10 UTSW 8 125671245 missense probably damaging 1.00
R6466:Map10 UTSW 8 125672384 nonsense probably null
R6557:Map10 UTSW 8 125670252 missense probably damaging 0.98
R6821:Map10 UTSW 8 125670399 missense probably benign 0.01
R7096:Map10 UTSW 8 125671923 missense probably damaging 0.99
R7128:Map10 UTSW 8 125671853 missense probably benign
R7177:Map10 UTSW 8 125671845 missense probably benign 0.23
R7237:Map10 UTSW 8 125671224 missense probably benign 0.03
R7814:Map10 UTSW 8 125671611 missense probably benign 0.14
R7819:Map10 UTSW 8 125670521 frame shift probably null
Z1088:Map10 UTSW 8 125671931 frame shift probably null
Z1177:Map10 UTSW 8 125670070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCAAAGATCGGTGGCAG -3'
(R):5'- ACTCATCAAAGCCTGCCCTG -3'

Sequencing Primer
(F):5'- GATCGGTGGCAGCCCCC -3'
(R):5'- GCCCTGATTTGCATTGAAGTATCAC -3'
Posted On2018-06-06