Incidental Mutation 'R6544:Lats1'
ID 521029
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Name large tumor suppressor
Synonyms
MMRRC Submission 044670-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R6544 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 7556978-7592224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7577434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 186 (V186D)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
AlphaFold Q8BYR2
Predicted Effect possibly damaging
Transcript: ENSMUST00000040043
AA Change: V186D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: V186D

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165952
AA Change: V186D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: V186D

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217931
AA Change: V186D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,036,678 (GRCm39) K118* probably null Het
Actr2 A G 11: 20,050,933 (GRCm39) F17L probably damaging Het
Adam26b T C 8: 43,974,818 (GRCm39) I61M probably damaging Het
Ahcyl A C 16: 45,975,147 (GRCm39) S77A probably benign Het
Ahnak2 A G 12: 112,746,829 (GRCm39) probably benign Het
Angptl3 T C 4: 98,919,675 (GRCm39) L145P probably damaging Het
Ank2 T C 3: 126,726,871 (GRCm39) T808A probably damaging Het
Ark2c T A 18: 77,650,931 (GRCm39) probably benign Het
Cadm3 A G 1: 173,194,977 (GRCm39) probably null Het
Cog7 C T 7: 121,534,966 (GRCm39) R573Q probably damaging Het
Dchs1 T A 7: 105,407,385 (GRCm39) I2110F probably damaging Het
Fbxo47 G A 11: 97,747,089 (GRCm39) R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 (GRCm39) D583V probably damaging Het
Gigyf1 T A 5: 137,523,321 (GRCm39) L911Q probably damaging Het
Gprin1 G A 13: 54,888,124 (GRCm39) A50V possibly damaging Het
Grik4 A T 9: 42,459,024 (GRCm39) Y571* probably null Het
Gucy2e A G 11: 69,126,483 (GRCm39) V299A probably benign Het
Hectd2 C T 19: 36,589,728 (GRCm39) L618F probably damaging Het
Lactbl1 A T 4: 136,360,300 (GRCm39) I160F possibly damaging Het
Lmtk2 A G 5: 144,110,624 (GRCm39) H448R possibly damaging Het
Map10 T C 8: 126,398,113 (GRCm39) I502T probably benign Het
Mok A G 12: 110,777,189 (GRCm39) F239S probably damaging Het
Mprip G A 11: 59,648,552 (GRCm39) G752D probably benign Het
Naip5 C A 13: 100,359,652 (GRCm39) G528V possibly damaging Het
Neu2 T C 1: 87,524,464 (GRCm39) W150R probably damaging Het
Or1ak2 T A 2: 36,827,539 (GRCm39) M136K possibly damaging Het
Or5an1 T C 19: 12,260,519 (GRCm39) Y36H probably damaging Het
Or5as1 T A 2: 86,980,207 (GRCm39) Y266F probably damaging Het
Or5l13 T A 2: 87,780,335 (GRCm39) M81L probably benign Het
Pip5k1c T A 10: 81,144,830 (GRCm39) Y224N probably damaging Het
Plch1 T C 3: 63,758,399 (GRCm39) E5G probably damaging Het
Pspc1 T C 14: 57,001,660 (GRCm39) *59W probably null Het
Ptprq T C 10: 107,444,102 (GRCm39) T1501A probably damaging Het
Rorb G T 19: 18,929,614 (GRCm39) P304T possibly damaging Het
Scn7a A T 2: 66,514,444 (GRCm39) L1110Q probably damaging Het
Serpine2 C T 1: 79,780,847 (GRCm39) probably null Het
Slco1c1 A G 6: 141,477,170 (GRCm39) probably null Het
Smarca2 T A 19: 26,608,331 (GRCm39) V130D probably damaging Het
Sox17 G T 1: 4,562,655 (GRCm39) P117T possibly damaging Het
Sparcl1 A T 5: 104,240,310 (GRCm39) Y371* probably null Het
Tdpoz2 T C 3: 93,559,267 (GRCm39) D235G possibly damaging Het
Tns2 A C 15: 102,022,269 (GRCm39) K1182N possibly damaging Het
Tpte G T 8: 22,805,121 (GRCm39) probably null Het
Ttn A T 2: 76,799,503 (GRCm39) I459K possibly damaging Het
Wdr97 T C 15: 76,242,478 (GRCm39) Y823H probably benign Het
Zc3h15 G A 2: 83,491,492 (GRCm39) R240H probably benign Het
Zfp455 C A 13: 67,355,121 (GRCm39) L130I probably benign Het
Zfp777 A T 6: 48,021,419 (GRCm39) S68T probably damaging Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7,567,330 (GRCm39) missense probably damaging 0.99
IGL00595:Lats1 APN 10 7,578,069 (GRCm39) missense probably benign 0.00
IGL00932:Lats1 APN 10 7,588,506 (GRCm39) missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7,581,435 (GRCm39) missense probably damaging 1.00
IGL01380:Lats1 APN 10 7,567,544 (GRCm39) missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7,577,470 (GRCm39) missense probably benign 0.10
IGL02027:Lats1 APN 10 7,588,712 (GRCm39) missense probably benign
IGL02611:Lats1 APN 10 7,581,551 (GRCm39) missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7,578,018 (GRCm39) missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7,588,510 (GRCm39) missense probably benign 0.15
I1329:Lats1 UTSW 10 7,588,566 (GRCm39) missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7,581,369 (GRCm39) missense probably damaging 1.00
R0153:Lats1 UTSW 10 7,567,339 (GRCm39) missense probably damaging 1.00
R0568:Lats1 UTSW 10 7,588,292 (GRCm39) missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7,578,705 (GRCm39) missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7,588,425 (GRCm39) missense probably damaging 0.96
R1681:Lats1 UTSW 10 7,581,678 (GRCm39) missense probably damaging 0.99
R1694:Lats1 UTSW 10 7,577,709 (GRCm39) missense probably benign 0.07
R1840:Lats1 UTSW 10 7,586,703 (GRCm39) nonsense probably null
R1914:Lats1 UTSW 10 7,586,221 (GRCm39) splice site probably benign
R2137:Lats1 UTSW 10 7,577,611 (GRCm39) missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7,567,540 (GRCm39) nonsense probably null
R3863:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R3864:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R4597:Lats1 UTSW 10 7,567,510 (GRCm39) missense probably benign 0.00
R4657:Lats1 UTSW 10 7,581,448 (GRCm39) missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7,578,493 (GRCm39) missense probably benign
R4663:Lats1 UTSW 10 7,588,347 (GRCm39) missense probably damaging 1.00
R4870:Lats1 UTSW 10 7,581,549 (GRCm39) missense probably damaging 1.00
R5101:Lats1 UTSW 10 7,588,348 (GRCm39) nonsense probably null
R5134:Lats1 UTSW 10 7,567,575 (GRCm39) missense probably benign 0.34
R5150:Lats1 UTSW 10 7,588,415 (GRCm39) missense probably benign
R5546:Lats1 UTSW 10 7,581,518 (GRCm39) missense probably damaging 0.99
R5820:Lats1 UTSW 10 7,581,672 (GRCm39) missense probably damaging 1.00
R6006:Lats1 UTSW 10 7,581,359 (GRCm39) missense probably damaging 1.00
R6301:Lats1 UTSW 10 7,578,871 (GRCm39) missense probably benign 0.01
R6647:Lats1 UTSW 10 7,573,271 (GRCm39) missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7,586,615 (GRCm39) missense probably damaging 1.00
R7328:Lats1 UTSW 10 7,581,311 (GRCm39) missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7,577,859 (GRCm39) nonsense probably null
R7438:Lats1 UTSW 10 7,588,706 (GRCm39) nonsense probably null
R7457:Lats1 UTSW 10 7,586,655 (GRCm39) missense probably damaging 1.00
R7524:Lats1 UTSW 10 7,577,742 (GRCm39) missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7,577,476 (GRCm39) missense probably damaging 1.00
R7736:Lats1 UTSW 10 7,578,128 (GRCm39) missense probably damaging 1.00
R7884:Lats1 UTSW 10 7,573,290 (GRCm39) nonsense probably null
R8166:Lats1 UTSW 10 7,577,880 (GRCm39) missense probably benign
R8248:Lats1 UTSW 10 7,581,667 (GRCm39) missense probably damaging 1.00
R8458:Lats1 UTSW 10 7,586,688 (GRCm39) nonsense probably null
R8477:Lats1 UTSW 10 7,581,279 (GRCm39) missense probably damaging 1.00
R8547:Lats1 UTSW 10 7,588,613 (GRCm39) missense probably damaging 1.00
R9163:Lats1 UTSW 10 7,578,052 (GRCm39) missense probably benign
R9441:Lats1 UTSW 10 7,578,681 (GRCm39) missense probably damaging 0.96
R9673:Lats1 UTSW 10 7,588,387 (GRCm39) missense probably benign 0.29
RF021:Lats1 UTSW 10 7,586,372 (GRCm39) missense probably damaging 1.00
X0026:Lats1 UTSW 10 7,586,387 (GRCm39) missense probably damaging 1.00
X0053:Lats1 UTSW 10 7,567,373 (GRCm39) missense probably benign 0.00
Z1176:Lats1 UTSW 10 7,581,573 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATTCCAGACCCTTTGAGGAC -3'
(R):5'- ACACTCCTAACTTGAGGTGGTGG -3'

Sequencing Primer
(F):5'- CATAGGTCCTCTGTAAGAGCAGC -3'
(R):5'- CTAACTTGAGGTGGTGGTGGGG -3'
Posted On 2018-06-06