Mutagenetix > Incidental Mutations

Incidental Mutation 'R6544:Lats1'

521029

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.871) question?

Stock #

R6544 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7701670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 186 (V186D)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040043
AA Change: V186D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: V186D

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165952
AA Change: V186D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: V186D

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217931
AA Change: V186D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A030005K14Rik	T	A	1: 83,058,957	K118*	probably null	Het
Actr2	A	G	11: 20,100,933	F17L	probably damaging	Het
Adam26b	T	C	8: 43,521,781	I61M	probably damaging	Het
Ahnak2	A	G	12: 112,780,652		probably benign	Het
Angptl3	T	C	4: 99,031,438	L145P	probably damaging	Het
Ank2	T	C	3: 126,933,222	T808A	probably damaging	Het
Cadm3	A	G	1: 173,367,411		probably null	Het
Cog7	C	T	7: 121,935,743	R573Q	probably damaging	Het
Dchs1	T	A	7: 105,758,178	I2110F	probably damaging	Het
Fbxo47	G	A	11: 97,856,263	R326C	probably damaging	Het
Frmpd1	A	T	4: 45,279,024	D583V	probably damaging	Het
Gigyf1	T	A	5: 137,525,059	L911Q	probably damaging	Het
Gm35339	T	C	15: 76,358,278	Y823H	probably benign	Het
Gm4737	A	C	16: 46,154,784	S77A	probably benign	Het
Gprin1	G	A	13: 54,740,311	A50V	possibly damaging	Het
Grik4	A	T	9: 42,547,728	Y571*	probably null	Het
Gucy2e	A	G	11: 69,235,657	V299A	probably benign	Het
Hectd2	C	T	19: 36,612,328	L618F	probably damaging	Het
Lactbl1	A	T	4: 136,632,989	I160F	possibly damaging	Het
Lmtk2	A	G	5: 144,173,806	H448R	possibly damaging	Het
Map10	T	C	8: 125,671,374	I502T	probably benign	Het
Mok	A	G	12: 110,810,755	F239S	probably damaging	Het
Mprip	G	A	11: 59,757,726	G752D	probably benign	Het
Naip5	C	A	13: 100,223,144	G528V	possibly damaging	Het
Neu2	T	C	1: 87,596,742	W150R	probably damaging	Het
Olfr1111	T	A	2: 87,149,863	Y266F	probably damaging	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr1434	T	C	19: 12,283,155	Y36H	probably damaging	Het
Olfr356	T	A	2: 36,937,527	M136K	possibly damaging	Het
Pip5k1c	T	A	10: 81,308,996	Y224N	probably damaging	Het
Plch1	T	C	3: 63,850,978	E5G	probably damaging	Het
Pspc1	T	C	14: 56,764,203	*59W	probably null	Het
Ptprq	T	C	10: 107,608,241	T1501A	probably damaging	Het
Rnf165	T	A	18: 77,563,235		probably benign	Het
Rorb	G	T	19: 18,952,250	P304T	possibly damaging	Het
Scn7a	A	T	2: 66,684,100	L1110Q	probably damaging	Het
Serpine2	C	T	1: 79,803,130		probably null	Het
Slco1c1	A	G	6: 141,531,444		probably null	Het
Smarca2	T	A	19: 26,630,931	V130D	probably damaging	Het
Sox17	G	T	1: 4,492,432	P117T	possibly damaging	Het
Sparcl1	A	T	5: 104,092,444	Y371*	probably null	Het
Tdpoz2	T	C	3: 93,651,960	D235G	possibly damaging	Het
Tns2	A	C	15: 102,113,834	K1182N	possibly damaging	Het
Tpte	G	T	8: 22,315,105		probably null	Het
Ttn	A	T	2: 76,969,159	I459K	possibly damaging	Het
Zc3h15	G	A	2: 83,661,148	R240H	probably benign	Het
Zfp455	C	A	13: 67,207,057	L130I	probably benign	Het
Zfp777	A	T	6: 48,044,485	S68T	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATTCCAGACCCTTTGAGGAC -3'
(R):5'- ACACTCCTAACTTGAGGTGGTGG -3'

Sequencing Primer
(F):5'- CATAGGTCCTCTGTAAGAGCAGC -3'
(R):5'- CTAACTTGAGGTGGTGGTGGGG -3'

Posted On

2018-06-06