Incidental Mutation 'R6544:Actr2'
ID521035
Institutional Source Beutler Lab
Gene Symbol Actr2
Ensembl Gene ENSMUSG00000020152
Gene NameARP2 actin-related protein 2
Synonyms4921510D23Rik, D6Ertd746e, Arp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location20062304-20112913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20100933 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 17 (F17L)
Ref Sequence ENSEMBL: ENSMUSP00000000137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000137]
Predicted Effect probably damaging
Transcript: ENSMUST00000000137
AA Change: F17L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000137
Gene: ENSMUSG00000020152
AA Change: F17L

DomainStartEndE-ValueType
ACTIN 6 390 2.78e-208 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134779
Meta Mutation Damage Score 0.6439 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for this mutation exhibit modifies lethality associated with F5 null Tfpi heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Actr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Actr2 APN 11 20094370 missense probably benign 0.03
IGL00164:Actr2 APN 11 20080015 splice site probably benign
IGL00566:Actr2 APN 11 20072487 missense possibly damaging 0.92
IGL00822:Actr2 APN 11 20094367 missense probably damaging 1.00
IGL02993:Actr2 APN 11 20072514 missense probably damaging 1.00
IGL03330:Actr2 APN 11 20091330 missense probably benign 0.01
R0092:Actr2 UTSW 11 20094308 missense probably benign 0.00
R0129:Actr2 UTSW 11 20100939 splice site probably benign
R0513:Actr2 UTSW 11 20080124 missense probably damaging 1.00
R0848:Actr2 UTSW 11 20072584 missense probably benign 0.02
R0863:Actr2 UTSW 11 20080760 missense probably benign 0.00
R5175:Actr2 UTSW 11 20080114 missense probably benign 0.25
R5364:Actr2 UTSW 11 20100797 intron probably benign
R7330:Actr2 UTSW 11 20072544 missense probably damaging 1.00
X0021:Actr2 UTSW 11 20080702 missense probably damaging 0.99
X0066:Actr2 UTSW 11 20080065 missense probably benign 0.00
X0066:Actr2 UTSW 11 20080066 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TATGCAAGAAGACTTTACGGCAC -3'
(R):5'- TCTCAAGTGTTCTGACAGTCC -3'

Sequencing Primer
(F):5'- CAAGAAGACTTTACGGCACTAATATG -3'
(R):5'- AAGTGTTCTGACAGTCCTCCAGG -3'
Posted On2018-06-06