Mutagenetix > Incidental Mutation

Incidental Mutation 'R6544:Gucy2e'

521039

Institutional Source

Beutler Lab

Gene Symbol

Gucy2e

Ensembl Gene

ENSMUSG00000020890

Gene Name

guanylate cyclase 2e

Synonyms

GC1, GC-E, ROS-GC1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R6544 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69218117-69237036 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69235657 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 299 (V299A)

Ref Sequence

ENSEMBL: ENSMUSP00000104305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]

AlphaFold

P52785

Predicted Effect

probably benign
Transcript: ENSMUST00000021259
AA Change: V299A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: V299A

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108664
AA Change: V299A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: V299A

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	2.4e-40	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	560	807	9.5e-23	PFAM
Pfam:Pkinase_Tyr	560	807	7.7e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108665
AA Change: V299A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: V299A

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155457

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158813

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A030005K14Rik	T	A	1: 83,058,957	K118*	probably null	Het
Actr2	A	G	11: 20,100,933	F17L	probably damaging	Het
Adam26b	T	C	8: 43,521,781	I61M	probably damaging	Het
Ahnak2	A	G	12: 112,780,652		probably benign	Het
Angptl3	T	C	4: 99,031,438	L145P	probably damaging	Het
Ank2	T	C	3: 126,933,222	T808A	probably damaging	Het
Cadm3	A	G	1: 173,367,411		probably null	Het
Cog7	C	T	7: 121,935,743	R573Q	probably damaging	Het
Dchs1	T	A	7: 105,758,178	I2110F	probably damaging	Het
Fbxo47	G	A	11: 97,856,263	R326C	probably damaging	Het
Frmpd1	A	T	4: 45,279,024	D583V	probably damaging	Het
Gigyf1	T	A	5: 137,525,059	L911Q	probably damaging	Het
Gm35339	T	C	15: 76,358,278	Y823H	probably benign	Het
Gm4737	A	C	16: 46,154,784	S77A	probably benign	Het
Gprin1	G	A	13: 54,740,311	A50V	possibly damaging	Het
Grik4	A	T	9: 42,547,728	Y571*	probably null	Het
Hectd2	C	T	19: 36,612,328	L618F	probably damaging	Het
Lactbl1	A	T	4: 136,632,989	I160F	possibly damaging	Het
Lats1	T	A	10: 7,701,670	V186D	possibly damaging	Het
Lmtk2	A	G	5: 144,173,806	H448R	possibly damaging	Het
Map10	T	C	8: 125,671,374	I502T	probably benign	Het
Mok	A	G	12: 110,810,755	F239S	probably damaging	Het
Mprip	G	A	11: 59,757,726	G752D	probably benign	Het
Naip5	C	A	13: 100,223,144	G528V	possibly damaging	Het
Neu2	T	C	1: 87,596,742	W150R	probably damaging	Het
Olfr1111	T	A	2: 87,149,863	Y266F	probably damaging	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr1434	T	C	19: 12,283,155	Y36H	probably damaging	Het
Olfr356	T	A	2: 36,937,527	M136K	possibly damaging	Het
Pip5k1c	T	A	10: 81,308,996	Y224N	probably damaging	Het
Plch1	T	C	3: 63,850,978	E5G	probably damaging	Het
Pspc1	T	C	14: 56,764,203	*59W	probably null	Het
Ptprq	T	C	10: 107,608,241	T1501A	probably damaging	Het
Rnf165	T	A	18: 77,563,235		probably benign	Het
Rorb	G	T	19: 18,952,250	P304T	possibly damaging	Het
Scn7a	A	T	2: 66,684,100	L1110Q	probably damaging	Het
Serpine2	C	T	1: 79,803,130		probably null	Het
Slco1c1	A	G	6: 141,531,444		probably null	Het
Smarca2	T	A	19: 26,630,931	V130D	probably damaging	Het
Sox17	G	T	1: 4,492,432	P117T	possibly damaging	Het
Sparcl1	A	T	5: 104,092,444	Y371*	probably null	Het
Tdpoz2	T	C	3: 93,651,960	D235G	possibly damaging	Het
Tns2	A	C	15: 102,113,834	K1182N	possibly damaging	Het
Tpte	G	T	8: 22,315,105		probably null	Het
Ttn	A	T	2: 76,969,159	I459K	possibly damaging	Het
Zc3h15	G	A	2: 83,661,148	R240H	probably benign	Het
Zfp455	C	A	13: 67,207,057	L130I	probably benign	Het
Zfp777	A	T	6: 48,044,485	S68T	probably damaging	Het

Other mutations in Gucy2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Gucy2e	APN	11	69223097	missense	possibly damaging	0.88
IGL01626:Gucy2e	APN	11	69232855	missense	possibly damaging	0.80
IGL01756:Gucy2e	APN	11	69232852	missense	probably damaging	0.98
IGL02030:Gucy2e	APN	11	69223816	missense	probably damaging	1.00
IGL02095:Gucy2e	APN	11	69232787	missense	possibly damaging	0.48
IGL02387:Gucy2e	APN	11	69236116	missense	probably benign
IGL02622:Gucy2e	APN	11	69225031	missense	probably damaging	1.00
IGL02660:Gucy2e	APN	11	69232007	missense	probably benign	0.18
IGL03181:Gucy2e	APN	11	69230182	splice site	probably benign
R0110:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0115:Gucy2e	UTSW	11	69236632	missense	unknown
R0450:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0469:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0497:Gucy2e	UTSW	11	69224159	missense	probably damaging	1.00
R0510:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R1252:Gucy2e	UTSW	11	69235659	missense	probably benign
R1535:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
R1700:Gucy2e	UTSW	11	69232058	missense	probably benign
R2035:Gucy2e	UTSW	11	69227532	missense	probably benign	0.12
R2179:Gucy2e	UTSW	11	69228578	splice site	probably null
R3622:Gucy2e	UTSW	11	69225051	missense	probably damaging	1.00
R4212:Gucy2e	UTSW	11	69228123	missense	probably damaging	0.99
R4600:Gucy2e	UTSW	11	69236168	missense	possibly damaging	0.71
R4790:Gucy2e	UTSW	11	69228448	missense	probably damaging	1.00
R5170:Gucy2e	UTSW	11	69235570	missense	probably damaging	0.97
R5174:Gucy2e	UTSW	11	69236566	missense	probably benign
R5440:Gucy2e	UTSW	11	69223646	missense	probably damaging	0.98
R5586:Gucy2e	UTSW	11	69226256	missense	probably damaging	1.00
R5668:Gucy2e	UTSW	11	69228381	missense	probably damaging	1.00
R5820:Gucy2e	UTSW	11	69232696	missense	probably benign	0.36
R5826:Gucy2e	UTSW	11	69236033	missense	possibly damaging	0.53
R6169:Gucy2e	UTSW	11	69236104	missense	probably benign	0.19
R6815:Gucy2e	UTSW	11	69232001	missense	possibly damaging	0.86
R7020:Gucy2e	UTSW	11	69232793	missense	probably benign	0.00
R7592:Gucy2e	UTSW	11	69223324	critical splice donor site	probably null
R7658:Gucy2e	UTSW	11	69226229	nonsense	probably null
R7812:Gucy2e	UTSW	11	69226243	missense	probably damaging	1.00
R8284:Gucy2e	UTSW	11	69232351	missense	probably benign
R8479:Gucy2e	UTSW	11	69232963	missense	probably benign	0.22
R8537:Gucy2e	UTSW	11	69236353	missense	probably benign	0.01
R8806:Gucy2e	UTSW	11	69236116	missense	probably benign
R9030:Gucy2e	UTSW	11	69225001	missense	probably damaging	1.00
R9192:Gucy2e	UTSW	11	69236477	missense	probably damaging	1.00
R9217:Gucy2e	UTSW	11	69235952	missense	possibly damaging	0.63
R9304:Gucy2e	UTSW	11	69235734	missense	probably benign	0.20
R9566:Gucy2e	UTSW	11	69228121	missense	probably damaging	1.00
R9784:Gucy2e	UTSW	11	69232690	missense	probably benign
X0025:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
Z1186:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1186:Gucy2e	UTSW	11	69236603	missense	unknown
Z1187:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1187:Gucy2e	UTSW	11	69236603	missense	unknown
Z1188:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1188:Gucy2e	UTSW	11	69236603	missense	unknown
Z1189:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1189:Gucy2e	UTSW	11	69236603	missense	unknown
Z1190:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1190:Gucy2e	UTSW	11	69236603	missense	unknown
Z1191:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1191:Gucy2e	UTSW	11	69236603	missense	unknown
Z1192:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1192:Gucy2e	UTSW	11	69236603	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGTTTACGCCCCATTGACTC -3'
(R):5'- CCGCAGTAGTGATCATGGTGATG -3'

Sequencing Primer
(F):5'- CAGCTCACTTCCCTGGC -3'
(R):5'- CAGTAGTGATCATGGTGATGCACTC -3'

Posted On

2018-06-06