Incidental Mutation 'R6519:Dnase1'
ID521044
Institutional Source Beutler Lab
Gene Symbol Dnase1
Ensembl Gene ENSMUSG00000005980
Gene Namedeoxyribonuclease I
SynonymsDNaseI, Dnl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4036942-4040024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4038589 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 132 (S132C)
Ref Sequence ENSEMBL: ENSMUSP00000135442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000157044] [ENSMUST00000175755] [ENSMUST00000177337]
Predicted Effect probably damaging
Transcript: ENSMUST00000006136
AA Change: S132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980
AA Change: S132C

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120009
AA Change: S132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980
AA Change: S132C

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132466
Predicted Effect probably damaging
Transcript: ENSMUST00000137748
AA Change: S132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980
AA Change: S132C

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150906
Predicted Effect probably benign
Transcript: ENSMUST00000157044
SMART Domains Protein: ENSMUSP00000120642
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 70 4.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect probably damaging
Transcript: ENSMUST00000177337
AA Change: S132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980
AA Change: S132C

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some heterozygote and homozygote null mice have autoimmune symptoms similar to systemic lupus erythematosus. These include enlarged lymph nodes, circulating auto-antibodies, kidney inflammation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Dnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Dnase1 APN 16 4039024 missense probably damaging 1.00
IGL00896:Dnase1 APN 16 4039212 missense probably benign 0.00
IGL00983:Dnase1 APN 16 4039553 missense possibly damaging 0.70
IGL02186:Dnase1 APN 16 4039032 missense probably benign 0.18
IGL03373:Dnase1 APN 16 4039843 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0355:Dnase1 UTSW 16 4039549 missense probably damaging 1.00
R0467:Dnase1 UTSW 16 4039149 missense probably damaging 1.00
R4964:Dnase1 UTSW 16 4037907 intron probably benign
R4966:Dnase1 UTSW 16 4037907 intron probably benign
R5014:Dnase1 UTSW 16 4039016 nonsense probably null
R5621:Dnase1 UTSW 16 4039118 missense probably benign 0.01
R5858:Dnase1 UTSW 16 4039649 splice site probably benign
R6256:Dnase1 UTSW 16 4037621 missense probably benign 0.06
R7002:Dnase1 UTSW 16 4039546 missense possibly damaging 0.76
R8050:Dnase1 UTSW 16 4037997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCTCTTTTACTTGGGAGG -3'
(R):5'- AATTCAGAGCACTGGGAGTTC -3'

Sequencing Primer
(F):5'- TCCTTATAGAGTAGGGGTAGCAATG -3'
(R):5'- GTAAGCTGTGACTCCATC -3'
Posted On2018-06-06