Incidental Mutation 'R6519:Lrch3'
ID521046
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms2210409B11Rik, LOC385628
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6519 (G1)
Quality Score171.009
Status Validated
Chromosome16
Chromosomal Location32914100-33015647 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) G to A at 32994997 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000023491] [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000135193] [ENSMUST00000135193] [ENSMUST00000165616] [ENSMUST00000165616] [ENSMUST00000165616] [ENSMUST00000165826] [ENSMUST00000165826] [ENSMUST00000165826] [ENSMUST00000170201] [ENSMUST00000170201] [ENSMUST00000170201] [ENSMUST00000170899] [ENSMUST00000170899] [ENSMUST00000170899]
Predicted Effect probably benign
Transcript: ENSMUST00000023491
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023491
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023491
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably benign
Transcript: ENSMUST00000135193
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135193
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135193
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000142290
AA Change: G134D
SMART Domains Protein: ENSMUSP00000117302
Gene: ENSMUSG00000022801
AA Change: G134D

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
SCOP:d1h67a_ 201 253 1e-11 SMART
Blast:CH 205 253 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163428
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163428
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163428
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165616
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165616
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165616
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170201
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170201
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170201
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170899
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170899
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170899
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32994965 missense probably benign 0.10
IGL01400:Lrch3 APN 16 32979541 missense probably damaging 1.00
IGL02565:Lrch3 APN 16 33005714 missense probably benign 0.00
IGL03076:Lrch3 APN 16 32981853 missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32952137 missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32914277 missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32955324 missense probably damaging 1.00
eluted UTSW 16 32986007 missense probably null
leached UTSW 16 32959463 missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32995852 intron probably benign
R0123:Lrch3 UTSW 16 32961754 splice site probably benign
R0225:Lrch3 UTSW 16 32961754 splice site probably benign
R0326:Lrch3 UTSW 16 32979500 missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32986880 missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32997483 nonsense probably null
R1204:Lrch3 UTSW 16 33009214 missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32988495 splice site probably benign
R1526:Lrch3 UTSW 16 32950376 missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32950411 nonsense probably null
R1850:Lrch3 UTSW 16 32986793 missense probably benign 0.01
R1966:Lrch3 UTSW 16 32914385 missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32995841 missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32961675 missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32950396 missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32988484 splice site probably null
R4795:Lrch3 UTSW 16 33005704 missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32914397 missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32975807 missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32985965 splice site probably null
R5470:Lrch3 UTSW 16 32998590 missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32914184 missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32998526 missense probably damaging 1.00
R5862:Lrch3 UTSW 16 32995809 missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32959463 missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32975736 missense probably damaging 1.00
R6731:Lrch3 UTSW 16 32950420 missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32993779 missense probably benign 0.05
R7197:Lrch3 UTSW 16 32990295 missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32994993 missense probably benign 0.19
R7392:Lrch3 UTSW 16 32986755 nonsense probably null
R7408:Lrch3 UTSW 16 32986743 nonsense probably null
R7414:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R7425:Lrch3 UTSW 16 33005707 missense probably damaging 1.00
R7909:Lrch3 UTSW 16 33009293 missense probably benign 0.00
R7956:Lrch3 UTSW 16 32986007 missense probably null
R8009:Lrch3 UTSW 16 33005713 missense possibly damaging 0.72
R8247:Lrch3 UTSW 16 33009343 nonsense probably null
R8408:Lrch3 UTSW 16 32955380 missense probably damaging 1.00
R8686:Lrch3 UTSW 16 32981853 missense possibly damaging 0.52
R8756:Lrch3 UTSW 16 32988440 missense probably benign 0.33
Z1176:Lrch3 UTSW 16 32914316 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGAGAGACTAGTTAGATCTTTAAAGA -3'
(R):5'- GCCAACTAGTAAAACCAGAAATTCT -3'

Sequencing Primer
(F):5'- GAAGTGCCCTTTCTTGAG -3'
(R):5'- AACTGTGCTAAGCCTGGTGAC -3'
Posted On2018-06-06