Incidental Mutation 'R6544:Gprin1'
ID521047
Institutional Source Beutler Lab
Gene Symbol Gprin1
Ensembl Gene ENSMUSG00000069227
Gene NameG protein-regulated inducer of neurite outgrowth 1
SynonymsGRIN1, Z16
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54736671-54749874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54740311 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 50 (A50V)
Ref Sequence ENSEMBL: ENSMUSP00000115539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145] [ENSMUST00000099506] [ENSMUST00000135343]
Predicted Effect probably benign
Transcript: ENSMUST00000037145
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099506
AA Change: A50V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097106
Gene: ENSMUSG00000069227
AA Change: A50V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 790 929 4.2e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135343
AA Change: A50V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115539
Gene: ENSMUSG00000069227
AA Change: A50V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 787 932 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Gprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Gprin1 APN 13 54740369 missense probably damaging 1.00
IGL02001:Gprin1 APN 13 54739192 missense probably damaging 1.00
IGL03188:Gprin1 APN 13 54738652 missense probably benign 0.02
IGL03308:Gprin1 APN 13 54740144 missense probably benign 0.05
R0980:Gprin1 UTSW 13 54740401 missense possibly damaging 0.75
R1638:Gprin1 UTSW 13 54739876 missense possibly damaging 0.53
R1942:Gprin1 UTSW 13 54739939 missense probably benign 0.36
R2145:Gprin1 UTSW 13 54738632 missense probably damaging 0.99
R2215:Gprin1 UTSW 13 54740233 missense probably damaging 0.99
R2338:Gprin1 UTSW 13 54738425 unclassified probably null
R3014:Gprin1 UTSW 13 54738475 missense probably benign 0.34
R4634:Gprin1 UTSW 13 54738058 missense probably damaging 1.00
R4732:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4733:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4903:Gprin1 UTSW 13 54737929 missense probably damaging 1.00
R4915:Gprin1 UTSW 13 54738073 missense probably damaging 1.00
R5102:Gprin1 UTSW 13 54739763 missense probably benign 0.06
R5979:Gprin1 UTSW 13 54739978 missense probably benign 0.01
R7007:Gprin1 UTSW 13 54738256 missense probably damaging 1.00
R7022:Gprin1 UTSW 13 54739042 missense probably benign 0.11
R7110:Gprin1 UTSW 13 54739243 missense probably benign 0.01
R7385:Gprin1 UTSW 13 54738610 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGGAGTTGCCATCCATCTTC -3'
(R):5'- TGCTTCAGAAGGACTCCAGC -3'

Sequencing Primer
(F):5'- TCTTCCCCGAGAACACAGGATTTC -3'
(R):5'- TCTGCTCCCCACAGGATG -3'
Posted On2018-06-06