Incidental Mutation 'R6519:Zfp955b'
ID521048
Institutional Source Beutler Lab
Gene Symbol Zfp955b
Ensembl Gene ENSMUSG00000096910
Gene Namezinc finger protein 955B
SynonymsA430003O12Rik, C430039G02Rik, Gm4455
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6519 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33289649-33303196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33302077 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 173 (S173R)
Ref Sequence ENSEMBL: ENSMUSP00000097011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099414
AA Change: S173R

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097011
Gene: ENSMUSG00000096910
AA Change: S173R

DomainStartEndE-ValueType
KRAB 10 70 3.04e-14 SMART
ZnF_C2H2 230 252 7.68e0 SMART
ZnF_C2H2 258 280 5.72e-1 SMART
ZnF_C2H2 290 312 6.75e0 SMART
ZnF_C2H2 318 340 5.81e-2 SMART
ZnF_C2H2 346 368 3.16e-3 SMART
ZnF_C2H2 374 396 1.18e-2 SMART
ZnF_C2H2 402 424 7.78e-3 SMART
ZnF_C2H2 430 452 3.16e-3 SMART
ZnF_C2H2 458 480 1.1e-2 SMART
ZnF_C2H2 486 508 2.09e-3 SMART
ZnF_C2H2 514 536 6.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Zfp955b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zfp955b APN 17 33302873 missense probably damaging 1.00
IGL02073:Zfp955b APN 17 33300590 missense possibly damaging 0.69
IGL02126:Zfp955b APN 17 33302264 nonsense probably null
IGL02237:Zfp955b APN 17 33301919 missense probably damaging 1.00
IGL02587:Zfp955b APN 17 33300650 missense probably damaging 1.00
IGL02971:Zfp955b APN 17 33300966 missense probably benign 0.11
IGL03034:Zfp955b APN 17 33302168 missense probably benign 0.22
IGL03493:Zfp955b APN 17 33302545 missense probably benign 0.35
R0269:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0373:Zfp955b UTSW 17 33302522 missense probably benign
R0617:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0684:Zfp955b UTSW 17 33302973 missense probably benign 0.00
R1778:Zfp955b UTSW 17 33302814 missense probably benign 0.07
R1874:Zfp955b UTSW 17 33305453 missense probably benign 0.10
R3893:Zfp955b UTSW 17 33302994 missense probably benign 0.01
R3938:Zfp955b UTSW 17 33305416 missense probably damaging 1.00
R4082:Zfp955b UTSW 17 33302155 missense probably benign 0.08
R4672:Zfp955b UTSW 17 33305259 unclassified probably benign
R4956:Zfp955b UTSW 17 33305235 unclassified probably benign
R4998:Zfp955b UTSW 17 33305151 unclassified probably benign
R5276:Zfp955b UTSW 17 33303057 missense probably damaging 1.00
R5341:Zfp955b UTSW 17 33305121 unclassified probably benign
R5558:Zfp955b UTSW 17 33302187 missense possibly damaging 0.88
R6086:Zfp955b UTSW 17 33302504 missense probably benign
R6170:Zfp955b UTSW 17 33302110 missense probably benign 0.00
R6306:Zfp955b UTSW 17 33303186 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCAGTCACGGTTTATGAAAGC -3'
(R):5'- TCCACATTGCTTATACTCAAGTGG -3'

Sequencing Primer
(F):5'- CAGTCACGGTTTATGAAAGCAGTGTG -3'
(R):5'- ACTCAAGTGGTTTTTCTCCAGTATG -3'
Posted On2018-06-06