Incidental Mutation 'R6544:Zfp455'
ID 521049
Institutional Source Beutler Lab
Gene Symbol Zfp455
Ensembl Gene ENSMUSG00000051037
Gene Name zinc finger protein 455
Synonyms Rslcan-10, 3732412P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock # R6544 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 67194506-67209298 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67207057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 130 (L130I)
Ref Sequence ENSEMBL: ENSMUSP00000112546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117110] [ENSMUST00000120861]
AlphaFold Q7M6X9
Predicted Effect probably benign
Transcript: ENSMUST00000117110
AA Change: L65I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113356
Gene: ENSMUSG00000051037
AA Change: L65I

DomainStartEndE-ValueType
ZnF_C2H2 44 66 7.15e-2 SMART
ZnF_C2H2 72 94 1.6e-4 SMART
ZnF_C2H2 100 122 2.12e-4 SMART
ZnF_C2H2 128 150 6.23e-2 SMART
ZnF_C2H2 184 206 1.01e-1 SMART
ZnF_C2H2 212 234 3.11e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 318 3.58e-2 SMART
ZnF_C2H2 324 346 2.24e-3 SMART
ZnF_C2H2 352 374 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120861
AA Change: L130I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112546
Gene: ENSMUSG00000051037
AA Change: L130I

DomainStartEndE-ValueType
KRAB 5 65 1.92e-34 SMART
ZnF_C2H2 109 131 7.15e-2 SMART
ZnF_C2H2 137 159 1.6e-4 SMART
ZnF_C2H2 165 187 2.12e-4 SMART
ZnF_C2H2 193 215 6.23e-2 SMART
ZnF_C2H2 249 271 1.01e-1 SMART
ZnF_C2H2 277 299 3.11e-2 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.58e-2 SMART
ZnF_C2H2 389 411 2.24e-3 SMART
ZnF_C2H2 417 439 7.9e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Zfp455
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zfp455 APN 13 67207898 missense probably benign 0.33
IGL03111:Zfp455 APN 13 67207999 missense probably benign 0.00
IGL03210:Zfp455 APN 13 67207049 missense possibly damaging 0.93
IGL03371:Zfp455 APN 13 67207002 nonsense probably null
PIT4504001:Zfp455 UTSW 13 67198621 missense probably damaging 0.98
R0245:Zfp455 UTSW 13 67207835 missense probably damaging 1.00
R0277:Zfp455 UTSW 13 67198664 splice site probably null
R1141:Zfp455 UTSW 13 67198591 missense probably damaging 1.00
R1266:Zfp455 UTSW 13 67206964 nonsense probably null
R1657:Zfp455 UTSW 13 67198639 missense possibly damaging 0.83
R1749:Zfp455 UTSW 13 67207009 missense probably damaging 1.00
R1757:Zfp455 UTSW 13 67207537 missense probably damaging 1.00
R1854:Zfp455 UTSW 13 67207817 missense probably damaging 1.00
R1867:Zfp455 UTSW 13 67207445 missense probably benign 0.33
R4411:Zfp455 UTSW 13 67207325 missense probably damaging 0.96
R6060:Zfp455 UTSW 13 67207193 missense probably damaging 1.00
R7132:Zfp455 UTSW 13 67199166 missense probably damaging 1.00
R7524:Zfp455 UTSW 13 67207624 missense possibly damaging 0.73
R7966:Zfp455 UTSW 13 67199238 missense probably benign
R8848:Zfp455 UTSW 13 67208025 missense possibly damaging 0.70
R8994:Zfp455 UTSW 13 67207414 missense probably damaging 1.00
Z1176:Zfp455 UTSW 13 67207043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAACTTTGGCTCAACAGG -3'
(R):5'- GACACATATTTCATCCTTGTAGGC -3'

Sequencing Primer
(F):5'- CTTTGGCTCAACAGGAATAATACC -3'
(R):5'- GCAAGGTTTCTCCCCAGAATG -3'
Posted On 2018-06-06