Incidental Mutation 'R6544:Pspc1'
ID521053
Institutional Source Beutler Lab
Gene Symbol Pspc1
Ensembl Gene ENSMUSG00000021938
Gene Nameparaspeckle protein 1
Synonyms5730470C09Rik, PSP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56720710-56778316 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 56764203 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 59 (*59W)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022507] [ENSMUST00000163924]
Predicted Effect probably damaging
Transcript: ENSMUST00000022507
AA Change: D238G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022507
Gene: ENSMUSG00000021938
AA Change: D238G

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
low complexity region 494 516 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163924
AA Change: D238G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133038
Gene: ENSMUSG00000021938
AA Change: D238G

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168524
Predicted Effect probably null
Transcript: ENSMUST00000168575
AA Change: *59W
SMART Domains Protein: ENSMUSP00000125780
Gene: ENSMUSG00000021938
AA Change: *59W

DomainStartEndE-ValueType
RRM 5 56 2.12e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Pspc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pspc1 APN 14 56771711 missense probably damaging 1.00
IGL02281:Pspc1 APN 14 56723178 missense probably benign
IGL02954:Pspc1 APN 14 56771760 missense probably benign 0.17
IGL02989:Pspc1 APN 14 56771696 intron probably benign
R1549:Pspc1 UTSW 14 56748941 missense probably damaging 1.00
R1696:Pspc1 UTSW 14 56764243 missense probably benign 0.15
R4574:Pspc1 UTSW 14 56761947 missense possibly damaging 0.91
R4599:Pspc1 UTSW 14 56777789 critical splice donor site probably null
R5132:Pspc1 UTSW 14 56723250 missense probably benign 0.09
R5243:Pspc1 UTSW 14 56764191 missense probably damaging 1.00
R5519:Pspc1 UTSW 14 56771956 missense probably benign 0.11
R5610:Pspc1 UTSW 14 56777931 missense probably damaging 1.00
R5724:Pspc1 UTSW 14 56778072 missense probably benign 0.01
R5867:Pspc1 UTSW 14 56762041 splice site probably null
R5968:Pspc1 UTSW 14 56764236 missense probably benign 0.14
R7034:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R7036:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R8009:Pspc1 UTSW 14 56771847 nonsense probably null
X0065:Pspc1 UTSW 14 56725415 missense possibly damaging 0.79
Z1177:Pspc1 UTSW 14 56748875 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATTCTATTTAGACCAAACCGCTC -3'
(R):5'- AACCATGCCTACCTATTTTGGC -3'

Sequencing Primer
(F):5'- ACCGCTCATTAACCAGATTGTATTC -3'
(R):5'- GTAGAGCATGCTGGCCTCAAATTC -3'
Posted On2018-06-06