Incidental Mutation 'R6520:Ptprc'
ID521057
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R6520 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 138080143 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 886 (Q886*)
Ref Sequence ENSEMBL: ENSMUSP00000138350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182283
AA Change: Q747*
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: Q747*

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182755
AA Change: Q723*
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: Q723*

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183301
AA Change: Q886*
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: Q886*

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik G T 2: 131,147,254 H111N probably damaging Het
1700093K21Rik T C 11: 23,517,285 D116G possibly damaging Het
Adam22 C T 5: 8,116,635 V699M probably damaging Het
Adh7 A G 3: 138,224,010 Y149C probably damaging Het
Angptl3 A C 4: 99,037,848 N405T probably benign Het
Ank3 A G 10: 69,988,387 H180R probably damaging Het
Apob T A 12: 7,983,124 I159N probably damaging Het
Arhgap24 T C 5: 102,880,793 V185A probably benign Het
Atf6 A T 1: 170,867,669 H11Q probably benign Het
Atxn3 C A 12: 101,934,401 D208Y probably damaging Het
Brd9 G A 13: 73,942,794 R273K probably benign Het
Cbfa2t3 T A 8: 122,635,801 R302W probably benign Het
Ccdc175 C A 12: 72,140,030 G347C probably damaging Het
Ccdc87 A G 19: 4,841,789 K770E probably damaging Het
Ccl17 T C 8: 94,810,550 F27L probably benign Het
Cd3g A T 9: 44,971,315 probably null Het
Cep350 A G 1: 155,933,336 V498A probably benign Het
Cfap45 A G 1: 172,540,584 D381G probably damaging Het
Cfap46 A G 7: 139,614,405 probably null Het
Cnrip1 T A 11: 17,078,536 M156K probably damaging Het
Col23a1 T C 11: 51,549,725 probably null Het
Col4a1 C T 8: 11,219,152 G933S probably damaging Het
Col5a3 C T 9: 20,774,052 V1443I unknown Het
Col6a6 T C 9: 105,785,825 E171G possibly damaging Het
Dennd1a A T 2: 37,961,747 probably null Het
Dlk2 C T 17: 46,302,512 T188I probably damaging Het
Dusp8 A G 7: 142,083,681 I203T probably damaging Het
Eno2 C T 6: 124,767,715 R56H probably damaging Het
Erich3 A T 3: 154,763,465 T1185S probably damaging Het
Evi5l A T 8: 4,205,906 Q575L possibly damaging Het
Fam187a T A 11: 102,885,875 H168Q possibly damaging Het
Fat2 T A 11: 55,284,988 E1633V probably damaging Het
Fbln2 G A 6: 91,259,659 D719N probably damaging Het
Fbn2 A T 18: 58,102,390 S672T probably damaging Het
Gas8 C G 8: 123,526,474 A187G probably benign Het
Gm2696 G A 10: 77,836,498 probably benign Het
Gnl1 A T 17: 35,982,953 K272M probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hemgn T G 4: 46,396,466 K257Q probably damaging Het
Hgsnat T C 8: 25,953,300 Y474C probably damaging Het
Hoxc4 T C 15: 103,034,954 S78P probably benign Het
Igkv14-100 T A 6: 68,519,234 L37Q probably damaging Het
Iqck A T 7: 118,941,631 K251M probably damaging Het
Itgal A T 7: 127,330,331 Q1140L probably benign Het
Itpka A G 2: 119,750,778 R431G probably benign Het
Jade1 A G 3: 41,604,482 N333D possibly damaging Het
Jmjd7 A G 2: 120,031,319 H181R probably damaging Het
Jmy A G 13: 93,454,039 S519P probably benign Het
Klra10 T A 6: 130,275,792 H173L probably benign Het
Krt72 T G 15: 101,781,046 I284L probably benign Het
Krt78 C A 15: 101,951,771 V237F probably benign Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Mcmbp A C 7: 128,712,727 V255G possibly damaging Het
Mcoln1 T G 8: 3,505,855 M50R probably damaging Het
Mocos T A 18: 24,666,390 V227E probably benign Het
Mpeg1 A G 19: 12,461,958 E260G probably benign Het
Mrc1 A T 2: 14,307,949 N894I probably damaging Het
Mroh7 A G 4: 106,721,263 S73P probably benign Het
Myo3a A T 2: 22,399,926 I690L possibly damaging Het
Naa50 T G 16: 44,159,509 F87V probably damaging Het
Ndufs6 G T 13: 73,328,352 T32K probably damaging Het
Nfe2l2 A G 2: 75,676,568 V396A probably benign Het
Nptn A G 9: 58,643,734 E348G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Olfr1083-ps A G 2: 86,607,118 L151P unknown Het
Olfr504 A G 7: 108,564,839 *319Q probably null Het
Olfr974 T C 9: 39,942,362 I34T possibly damaging Het
Plekha7 A G 7: 116,164,482 V233A probably benign Het
Polq C A 16: 37,060,377 Q968K possibly damaging Het
Prmt7 C T 8: 106,234,884 T143M probably damaging Het
Rbp7 C A 4: 149,452,914 V36L possibly damaging Het
Rev3l A T 10: 39,822,702 N1065I probably benign Het
Scamp5 A T 9: 57,447,206 probably null Het
Sec16a A G 2: 26,426,106 S1698P probably damaging Het
Spr C A 6: 85,137,492 R85L probably benign Het
Sptlc2 A C 12: 87,355,662 N163K probably benign Het
Stk10 C T 11: 32,588,839 T226M probably damaging Het
Sv2c A G 13: 95,986,721 Y415H probably benign Het
Tet1 A G 10: 62,880,013 M1T probably null Het
Tnnt1 T A 7: 4,509,061 K150* probably null Het
Trappc10 C T 10: 78,201,453 V839M probably benign Het
Ubap2 T C 4: 41,195,155 N1131S probably damaging Het
Upk2 T C 9: 44,453,506 E132G probably damaging Het
Vmn2r117 A T 17: 23,460,219 V677D probably damaging Het
Vps13a A T 19: 16,725,579 L670H probably damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp512 G A 5: 31,466,640 R67H probably damaging Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zzef1 C A 11: 72,826,065 N360K probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Chor_muang UTSW 1 138113562 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGAGCTTCTGATGAAAATTAGCTC -3'
(R):5'- ATGGAGGAGAGCTTTATTGAGC -3'

Sequencing Primer
(F):5'- ACTACTGCCCCAGAAGAT -3'
(R):5'- CAGGGATCAAGTTCATGTCAACAGTC -3'
Posted On2018-06-06