Incidental Mutation 'R6544:Rnf165'
ID521060
Institutional Source Beutler Lab
Gene Symbol Rnf165
Ensembl Gene ENSMUSG00000025427
Gene Namering finger protein 165
SynonymsG630064H08Rik, Ark2c, LOC225743, 2900024M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77456110-77565147 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 77563235 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026494] [ENSMUST00000182024] [ENSMUST00000182146]
Predicted Effect probably benign
Transcript: ENSMUST00000026494
SMART Domains Protein: ENSMUSP00000026494
Gene: ENSMUSG00000025427

DomainStartEndE-ValueType
low complexity region 99 121 N/A INTRINSIC
RING 295 335 1.4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182024
SMART Domains Protein: ENSMUSP00000138494
Gene: ENSMUSG00000025427

DomainStartEndE-ValueType
RING 102 142 1.4e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182146
AA Change: T8S
Predicted Effect probably benign
Transcript: ENSMUST00000182153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182294
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Encoded in regions involved in pericentric inversions in patients with bipolar affective disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial neonatal lethality followed by complete postnatal lethality, growth retardation, abnormal joint mobility, cyanosis, abnormal motor neuron innervation pattern and abnormal phrenic nerve innervation pattern to diaphragm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Rnf165
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rnf165 APN 18 77462914 missense probably damaging 1.00
IGL02014:Rnf165 APN 18 77468359 missense probably damaging 0.99
IGL03210:Rnf165 APN 18 77466739 missense probably damaging 1.00
R0486:Rnf165 UTSW 18 77484254 missense probably damaging 0.97
R1523:Rnf165 UTSW 18 77462938 missense probably benign 0.17
R1650:Rnf165 UTSW 18 77462417 unclassified probably null
R1853:Rnf165 UTSW 18 77462975 missense possibly damaging 0.68
R3402:Rnf165 UTSW 18 77565086 missense probably benign 0.02
R5039:Rnf165 UTSW 18 77462912 missense probably damaging 1.00
R5415:Rnf165 UTSW 18 77466739 missense probably damaging 1.00
R5875:Rnf165 UTSW 18 77563181 intron probably benign
R7873:Rnf165 UTSW 18 77466753 missense possibly damaging 0.80
R7956:Rnf165 UTSW 18 77466753 missense possibly damaging 0.80
X0067:Rnf165 UTSW 18 77462950 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGGAACCAGCAAGCTG -3'
(R):5'- TCAGTGAATGGTCAACTCGC -3'

Sequencing Primer
(F):5'- CAAGCTGCAATGGTATTTAGGGATC -3'
(R):5'- AATGGTCAACTCGCTGCTG -3'
Posted On2018-06-06