Mutagenetix > Incidental Mutation

Incidental Mutation 'R6545:Rpsa'

521116

Institutional Source

Beutler Lab

Gene Symbol

Rpsa

Ensembl Gene

ENSMUSG00000032518

Gene Name

ribosomal protein SA

Synonyms

P40-3, Lamrl1, Lamr1, Lamr, P40-8, 67lr

MMRRC Submission

044671-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6545 (G1)

Quality Score

136.008

Status

Validated

Chromosome

Chromosomal Location

119956832-119961435 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119959323 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 47 (H47R)

Ref Sequence

ENSEMBL: ENSMUSP00000149650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]

AlphaFold

P14206

Predicted Effect

probably benign
Transcript: ENSMUST00000035105
AA Change: H131R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: H131R

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S2	18	118	3.7e-12	PFAM
Pfam:Ribosomal_S2	111	184	6.5e-14	PFAM
Pfam:40S_SA_C	202	295	2.9e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216043

Predicted Effect

probably benign
Transcript: ENSMUST00000217317
AA Change: H131R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000217352
AA Change: H47R

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216813

Predicted Effect

probably benign
Transcript: ENSMUST00000217356

Meta Mutation Damage Score

0.3601

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago1	C	T	4: 126,348,145 (GRCm39)	A58T	possibly damaging	Het
Ago4	T	A	4: 126,405,811 (GRCm39)	Q366L	probably benign	Het
Card10	C	A	15: 78,661,010 (GRCm39)	G950V	probably damaging	Het
Ceacam1	A	T	7: 25,173,279 (GRCm39)	V303D	probably damaging	Het
Cfap54	C	T	10: 92,672,319 (GRCm39)	R2917H	probably benign	Het
Cit	A	G	5: 115,984,493 (GRCm39)	S22G	probably null	Het
Cog4	A	G	8: 111,607,577 (GRCm39)	E666G	probably damaging	Het
Crocc2	A	G	1: 93,140,659 (GRCm39)	D1103G	probably benign	Het
Cttnbp2	A	T	6: 18,405,278 (GRCm39)		probably null	Het
Dctn3	T	C	4: 41,723,084 (GRCm39)	E16G	probably damaging	Het
Dnah6	A	G	6: 73,021,715 (GRCm39)	S3536P	probably damaging	Het
Eef2	T	A	10: 81,016,948 (GRCm39)	I675N	probably damaging	Het
Gga3	A	G	11: 115,477,995 (GRCm39)	F531S	possibly damaging	Het
Gm19410	A	G	8: 36,257,652 (GRCm39)	R697G	possibly damaging	Het
Gm3173	T	A	14: 15,728,395 (GRCm39)	M18K	possibly damaging	Het
Gm5800	A	T	14: 51,949,419 (GRCm39)	S175R	possibly damaging	Het
Gria2	T	C	3: 80,648,451 (GRCm39)	K95R	probably damaging	Het
Gstm6	A	G	3: 107,849,681 (GRCm39)	I76T	probably damaging	Het
Harbi1	T	G	2: 91,542,640 (GRCm39)	Y34D	probably damaging	Het
Hectd2	C	A	19: 36,564,778 (GRCm39)	Q20K	probably benign	Het
Inpp5f	C	A	7: 128,296,280 (GRCm39)	A250D	possibly damaging	Het
Irf9	T	C	14: 55,842,684 (GRCm39)	F59L	probably damaging	Het
Itgam	T	A	7: 127,707,044 (GRCm39)	M625K	probably damaging	Het
Kcnh5	C	T	12: 75,054,432 (GRCm39)	R504Q	probably damaging	Het
Lama2	T	C	10: 27,052,793 (GRCm39)	T1389A	probably benign	Het
Lin54	T	A	5: 100,632,996 (GRCm39)		probably null	Het
Mettl23	A	G	11: 116,740,042 (GRCm39)	D171G	possibly damaging	Het
Mgll	A	G	6: 88,802,685 (GRCm39)	N296S	probably benign	Het
Mpv17	T	A	5: 31,302,041 (GRCm39)		probably benign	Het
Myof	A	T	19: 37,930,745 (GRCm39)	M1001K	possibly damaging	Het
Myom1	A	T	17: 71,389,300 (GRCm39)	Q850L	probably benign	Het
Or10ab5	A	T	7: 108,245,662 (GRCm39)	N40K	probably damaging	Het
Pias2	A	G	18: 77,217,781 (GRCm39)	I328V	possibly damaging	Het
Polh	G	A	17: 46,493,685 (GRCm39)	P311S	possibly damaging	Het
Prss34	A	T	17: 25,517,809 (GRCm39)	R61S	probably benign	Het
Rassf2	A	T	2: 131,840,237 (GRCm39)	M280K	probably damaging	Het
Rtp3	A	G	9: 110,815,894 (GRCm39)	V219A	possibly damaging	Het
Smarcc2	T	C	10: 128,319,997 (GRCm39)	I790T	probably benign	Het
Stag3	A	G	5: 138,296,614 (GRCm39)	T491A	possibly damaging	Het
Svil	C	T	18: 5,108,621 (GRCm39)	H2007Y	probably benign	Het
Togaram1	T	G	12: 65,024,981 (GRCm39)	C750G	possibly damaging	Het
Vmn2r13	A	T	5: 109,304,806 (GRCm39)		probably null	Het
Vmn2r4	A	T	3: 64,313,777 (GRCm39)	D401E	possibly damaging	Het
Wdr97	C	T	15: 76,247,578 (GRCm39)	R1585C	probably damaging	Het
Wsb1	A	T	11: 79,141,881 (GRCm39)	D45E	probably damaging	Het
Zfp808	T	A	13: 62,319,709 (GRCm39)	Y313N	probably benign	Het

Other mutations in Rpsa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02503:Rpsa	APN	9	119,957,659 (GRCm39)	missense	possibly damaging	0.57
IGL02522:Rpsa	APN	9	119,960,121 (GRCm39)	missense	possibly damaging	0.47
PIT4515001:Rpsa	UTSW	9	119,960,214 (GRCm39)	missense	probably benign	0.04
R0281:Rpsa	UTSW	9	119,960,069 (GRCm39)	missense	possibly damaging	0.81
R1511:Rpsa	UTSW	9	119,960,066 (GRCm39)	missense	possibly damaging	0.64
R4942:Rpsa	UTSW	9	119,960,129 (GRCm39)	missense	probably benign	0.04
R5814:Rpsa	UTSW	9	119,957,551 (GRCm39)	start gained	probably benign
R6122:Rpsa	UTSW	9	119,960,102 (GRCm39)	missense	probably benign	0.01
R7225:Rpsa	UTSW	9	119,960,222 (GRCm39)	missense	probably benign	0.00
R8554:Rpsa	UTSW	9	119,958,317 (GRCm39)	missense	possibly damaging	0.80
RF012:Rpsa	UTSW	9	119,960,105 (GRCm39)	missense	probably benign	0.01
Z1176:Rpsa	UTSW	9	119,959,412 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCGTGAAGCATGCATG -3'
(R):5'- ACTTGTGAGTTCATCGACCAGC -3'

Sequencing Primer
(F):5'- CCTCGTGAAGCATGCATGATAATG -3'
(R):5'- TTCATCGACCAGCGTGTGAC -3'

Posted On

2018-06-06