Incidental Mutation 'R6520:Cfap46'
ID521133
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6520 (G1)
Quality Score198.009
Status Not validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 139614405 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000129990] [ENSMUST00000129990]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093991
SMART Domains Protein: ENSMUSP00000091527
Gene: ENSMUSG00000070357

DomainStartEndE-ValueType
Pfam:Peptidase_C50 21 290 9.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166503
SMART Domains Protein: ENSMUSP00000126077
Gene: ENSMUSG00000070357

DomainStartEndE-ValueType
low complexity region 31 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik G T 2: 131,147,254 H111N probably damaging Het
1700093K21Rik T C 11: 23,517,285 D116G possibly damaging Het
Adam22 C T 5: 8,116,635 V699M probably damaging Het
Adh7 A G 3: 138,224,010 Y149C probably damaging Het
Angptl3 A C 4: 99,037,848 N405T probably benign Het
Ank3 A G 10: 69,988,387 H180R probably damaging Het
Apob T A 12: 7,983,124 I159N probably damaging Het
Arhgap24 T C 5: 102,880,793 V185A probably benign Het
Atf6 A T 1: 170,867,669 H11Q probably benign Het
Atxn3 C A 12: 101,934,401 D208Y probably damaging Het
Brd9 G A 13: 73,942,794 R273K probably benign Het
Cbfa2t3 T A 8: 122,635,801 R302W probably benign Het
Ccdc175 C A 12: 72,140,030 G347C probably damaging Het
Ccdc87 A G 19: 4,841,789 K770E probably damaging Het
Ccl17 T C 8: 94,810,550 F27L probably benign Het
Cd3g A T 9: 44,971,315 probably null Het
Cep350 A G 1: 155,933,336 V498A probably benign Het
Cfap45 A G 1: 172,540,584 D381G probably damaging Het
Cnrip1 T A 11: 17,078,536 M156K probably damaging Het
Col23a1 T C 11: 51,549,725 probably null Het
Col4a1 C T 8: 11,219,152 G933S probably damaging Het
Col5a3 C T 9: 20,774,052 V1443I unknown Het
Col6a6 T C 9: 105,785,825 E171G possibly damaging Het
Dennd1a A T 2: 37,961,747 probably null Het
Dlk2 C T 17: 46,302,512 T188I probably damaging Het
Dusp8 A G 7: 142,083,681 I203T probably damaging Het
Eno2 C T 6: 124,767,715 R56H probably damaging Het
Erich3 A T 3: 154,763,465 T1185S probably damaging Het
Evi5l A T 8: 4,205,906 Q575L possibly damaging Het
Fam187a T A 11: 102,885,875 H168Q possibly damaging Het
Fat2 T A 11: 55,284,988 E1633V probably damaging Het
Fbln2 G A 6: 91,259,659 D719N probably damaging Het
Fbn2 A T 18: 58,102,390 S672T probably damaging Het
Gas8 C G 8: 123,526,474 A187G probably benign Het
Gm2696 G A 10: 77,836,498 probably benign Het
Gnl1 A T 17: 35,982,953 K272M probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hemgn T G 4: 46,396,466 K257Q probably damaging Het
Hgsnat T C 8: 25,953,300 Y474C probably damaging Het
Hoxc4 T C 15: 103,034,954 S78P probably benign Het
Igkv14-100 T A 6: 68,519,234 L37Q probably damaging Het
Iqck A T 7: 118,941,631 K251M probably damaging Het
Itgal A T 7: 127,330,331 Q1140L probably benign Het
Itpka A G 2: 119,750,778 R431G probably benign Het
Jade1 A G 3: 41,604,482 N333D possibly damaging Het
Jmjd7 A G 2: 120,031,319 H181R probably damaging Het
Jmy A G 13: 93,454,039 S519P probably benign Het
Klra10 T A 6: 130,275,792 H173L probably benign Het
Krt72 T G 15: 101,781,046 I284L probably benign Het
Krt78 C A 15: 101,951,771 V237F probably benign Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Mcmbp A C 7: 128,712,727 V255G possibly damaging Het
Mcoln1 T G 8: 3,505,855 M50R probably damaging Het
Mocos T A 18: 24,666,390 V227E probably benign Het
Mpeg1 A G 19: 12,461,958 E260G probably benign Het
Mrc1 A T 2: 14,307,949 N894I probably damaging Het
Mroh7 A G 4: 106,721,263 S73P probably benign Het
Myo3a A T 2: 22,399,926 I690L possibly damaging Het
Naa50 T G 16: 44,159,509 F87V probably damaging Het
Ndufs6 G T 13: 73,328,352 T32K probably damaging Het
Nfe2l2 A G 2: 75,676,568 V396A probably benign Het
Nptn A G 9: 58,643,734 E348G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Olfr1083-ps A G 2: 86,607,118 L151P unknown Het
Olfr504 A G 7: 108,564,839 *319Q probably null Het
Olfr974 T C 9: 39,942,362 I34T possibly damaging Het
Plekha7 A G 7: 116,164,482 V233A probably benign Het
Polq C A 16: 37,060,377 Q968K possibly damaging Het
Prmt7 C T 8: 106,234,884 T143M probably damaging Het
Ptprc G A 1: 138,080,143 Q886* probably null Het
Rbp7 C A 4: 149,452,914 V36L possibly damaging Het
Rev3l A T 10: 39,822,702 N1065I probably benign Het
Scamp5 A T 9: 57,447,206 probably null Het
Sec16a A G 2: 26,426,106 S1698P probably damaging Het
Spr C A 6: 85,137,492 R85L probably benign Het
Sptlc2 A C 12: 87,355,662 N163K probably benign Het
Stk10 C T 11: 32,588,839 T226M probably damaging Het
Sv2c A G 13: 95,986,721 Y415H probably benign Het
Tet1 A G 10: 62,880,013 M1T probably null Het
Tnnt1 T A 7: 4,509,061 K150* probably null Het
Trappc10 C T 10: 78,201,453 V839M probably benign Het
Ubap2 T C 4: 41,195,155 N1131S probably damaging Het
Upk2 T C 9: 44,453,506 E132G probably damaging Het
Vmn2r117 A T 17: 23,460,219 V677D probably damaging Het
Vps13a A T 19: 16,725,579 L670H probably damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp512 G A 5: 31,466,640 R67H probably damaging Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zzef1 C A 11: 72,826,065 N360K probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7980:Cfap46 UTSW 7 139679741 intron probably null
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCTGTCTCCAGATGTGAGG -3'
(R):5'- TGAGTACAAGTCATATCCAGTCACC -3'

Sequencing Primer
(F):5'- GGATCTGGCCTTCAGCTACAC -3'
(R):5'- CACTGGACAACAAGCTATGATTCGG -3'
Posted On2018-06-06