Incidental Mutation 'R6520:Dusp8'
ID521135
Institutional Source Beutler Lab
Gene Symbol Dusp8
Ensembl Gene ENSMUSG00000037887
Gene Namedual specificity phosphatase 8
Synonyms5530400B01Rik, Nttp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6520 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142079490-142095843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142083681 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 203 (I203T)
Ref Sequence ENSEMBL: ENSMUSP00000049414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039926] [ENSMUST00000143661]
Predicted Effect probably damaging
Transcript: ENSMUST00000039926
AA Change: I203T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049414
Gene: ENSMUSG00000037887
AA Change: I203T

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
DSPc 160 299 3.6e-69 SMART
low complexity region 334 353 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 488 512 N/A INTRINSIC
low complexity region 546 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143661
AA Change: I203T

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114307
Gene: ENSMUSG00000037887
AA Change: I203T

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
Pfam:DSPc 168 231 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myocardial fiber morphology, mildly increased cardiac muscle contractility at baseline, and decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik G T 2: 131,147,254 H111N probably damaging Het
1700093K21Rik T C 11: 23,517,285 D116G possibly damaging Het
Adam22 C T 5: 8,116,635 V699M probably damaging Het
Adh7 A G 3: 138,224,010 Y149C probably damaging Het
Angptl3 A C 4: 99,037,848 N405T probably benign Het
Ank3 A G 10: 69,988,387 H180R probably damaging Het
Apob T A 12: 7,983,124 I159N probably damaging Het
Arhgap24 T C 5: 102,880,793 V185A probably benign Het
Atf6 A T 1: 170,867,669 H11Q probably benign Het
Atxn3 C A 12: 101,934,401 D208Y probably damaging Het
Brd9 G A 13: 73,942,794 R273K probably benign Het
Cbfa2t3 T A 8: 122,635,801 R302W probably benign Het
Ccdc175 C A 12: 72,140,030 G347C probably damaging Het
Ccdc87 A G 19: 4,841,789 K770E probably damaging Het
Ccl17 T C 8: 94,810,550 F27L probably benign Het
Cd3g A T 9: 44,971,315 probably null Het
Cep350 A G 1: 155,933,336 V498A probably benign Het
Cfap45 A G 1: 172,540,584 D381G probably damaging Het
Cfap46 A G 7: 139,614,405 probably null Het
Cnrip1 T A 11: 17,078,536 M156K probably damaging Het
Col23a1 T C 11: 51,549,725 probably null Het
Col4a1 C T 8: 11,219,152 G933S probably damaging Het
Col5a3 C T 9: 20,774,052 V1443I unknown Het
Col6a6 T C 9: 105,785,825 E171G possibly damaging Het
Dennd1a A T 2: 37,961,747 probably null Het
Dlk2 C T 17: 46,302,512 T188I probably damaging Het
Eno2 C T 6: 124,767,715 R56H probably damaging Het
Erich3 A T 3: 154,763,465 T1185S probably damaging Het
Evi5l A T 8: 4,205,906 Q575L possibly damaging Het
Fam187a T A 11: 102,885,875 H168Q possibly damaging Het
Fat2 T A 11: 55,284,988 E1633V probably damaging Het
Fbln2 G A 6: 91,259,659 D719N probably damaging Het
Fbn2 A T 18: 58,102,390 S672T probably damaging Het
Gas8 C G 8: 123,526,474 A187G probably benign Het
Gm2696 G A 10: 77,836,498 probably benign Het
Gnl1 A T 17: 35,982,953 K272M probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hemgn T G 4: 46,396,466 K257Q probably damaging Het
Hgsnat T C 8: 25,953,300 Y474C probably damaging Het
Hoxc4 T C 15: 103,034,954 S78P probably benign Het
Igkv14-100 T A 6: 68,519,234 L37Q probably damaging Het
Iqck A T 7: 118,941,631 K251M probably damaging Het
Itgal A T 7: 127,330,331 Q1140L probably benign Het
Itpka A G 2: 119,750,778 R431G probably benign Het
Jade1 A G 3: 41,604,482 N333D possibly damaging Het
Jmjd7 A G 2: 120,031,319 H181R probably damaging Het
Jmy A G 13: 93,454,039 S519P probably benign Het
Klra10 T A 6: 130,275,792 H173L probably benign Het
Krt72 T G 15: 101,781,046 I284L probably benign Het
Krt78 C A 15: 101,951,771 V237F probably benign Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Mcmbp A C 7: 128,712,727 V255G possibly damaging Het
Mcoln1 T G 8: 3,505,855 M50R probably damaging Het
Mocos T A 18: 24,666,390 V227E probably benign Het
Mpeg1 A G 19: 12,461,958 E260G probably benign Het
Mrc1 A T 2: 14,307,949 N894I probably damaging Het
Mroh7 A G 4: 106,721,263 S73P probably benign Het
Myo3a A T 2: 22,399,926 I690L possibly damaging Het
Naa50 T G 16: 44,159,509 F87V probably damaging Het
Ndufs6 G T 13: 73,328,352 T32K probably damaging Het
Nfe2l2 A G 2: 75,676,568 V396A probably benign Het
Nptn A G 9: 58,643,734 E348G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Olfr1083-ps A G 2: 86,607,118 L151P unknown Het
Olfr504 A G 7: 108,564,839 *319Q probably null Het
Olfr974 T C 9: 39,942,362 I34T possibly damaging Het
Plekha7 A G 7: 116,164,482 V233A probably benign Het
Polq C A 16: 37,060,377 Q968K possibly damaging Het
Prmt7 C T 8: 106,234,884 T143M probably damaging Het
Ptprc G A 1: 138,080,143 Q886* probably null Het
Rbp7 C A 4: 149,452,914 V36L possibly damaging Het
Rev3l A T 10: 39,822,702 N1065I probably benign Het
Scamp5 A T 9: 57,447,206 probably null Het
Sec16a A G 2: 26,426,106 S1698P probably damaging Het
Spr C A 6: 85,137,492 R85L probably benign Het
Sptlc2 A C 12: 87,355,662 N163K probably benign Het
Stk10 C T 11: 32,588,839 T226M probably damaging Het
Sv2c A G 13: 95,986,721 Y415H probably benign Het
Tet1 A G 10: 62,880,013 M1T probably null Het
Tnnt1 T A 7: 4,509,061 K150* probably null Het
Trappc10 C T 10: 78,201,453 V839M probably benign Het
Ubap2 T C 4: 41,195,155 N1131S probably damaging Het
Upk2 T C 9: 44,453,506 E132G probably damaging Het
Vmn2r117 A T 17: 23,460,219 V677D probably damaging Het
Vps13a A T 19: 16,725,579 L670H probably damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp512 G A 5: 31,466,640 R67H probably damaging Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zzef1 C A 11: 72,826,065 N360K probably damaging Het
Other mutations in Dusp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Dusp8 APN 7 142084423 missense probably benign 0.05
IGL02458:Dusp8 APN 7 142082747 missense probably benign 0.28
IGL02931:Dusp8 APN 7 142082930 missense probably benign 0.00
IGL03329:Dusp8 APN 7 142084360 nonsense probably null
R0009:Dusp8 UTSW 7 142082054 unclassified probably benign
R1054:Dusp8 UTSW 7 142082067 unclassified probably benign
R1611:Dusp8 UTSW 7 142082957 missense probably benign 0.04
R1883:Dusp8 UTSW 7 142084348 splice site probably null
R2119:Dusp8 UTSW 7 142082561 missense possibly damaging 0.91
R2326:Dusp8 UTSW 7 142090063 missense probably damaging 1.00
R2698:Dusp8 UTSW 7 142081964 unclassified probably benign
R2905:Dusp8 UTSW 7 142083389 nonsense probably null
R3849:Dusp8 UTSW 7 142090065 missense probably damaging 1.00
R4921:Dusp8 UTSW 7 142082154 unclassified probably benign
R4942:Dusp8 UTSW 7 142082228 missense possibly damaging 0.85
R5288:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5385:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5386:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R6301:Dusp8 UTSW 7 142083019 splice site probably null
R6665:Dusp8 UTSW 7 142090105 missense probably damaging 0.97
RF016:Dusp8 UTSW 7 142082852 missense probably benign 0.04
X0064:Dusp8 UTSW 7 142082027 unclassified probably benign
Z1176:Dusp8 UTSW 7 142081943 missense unknown
Z1176:Dusp8 UTSW 7 142090077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCCCTATGGCAGACAG -3'
(R):5'- GGGCATCACAGGACTTTAGAG -3'

Sequencing Primer
(F):5'- AGACAGTGCTGGGTGGC -3'
(R):5'- GACTTTAGAGTCCTTCTGAGAGAGAC -3'
Posted On2018-06-06