Incidental Mutation 'R6546:Slc19a3'
ID521162
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R6546 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83026360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 7 (T7A)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
AA Change: T7A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: T7A

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
AA Change: T7A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: T7A

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,799,299 L242M probably damaging Het
Atad2b A T 12: 4,990,949 H206L probably damaging Het
Bmp2k A G 5: 97,088,078 Q1120R probably benign Het
Cdk18 G A 1: 132,122,350 T29I probably damaging Het
Chrna3 T A 9: 55,015,901 I208F probably damaging Het
Dhrs1 G A 14: 55,741,272 P140S possibly damaging Het
Dnah14 C T 1: 181,738,987 R2775C probably damaging Het
Fam71e2 T C 7: 4,758,465 D416G probably benign Het
Fnip1 T G 11: 54,502,611 N600K probably benign Het
Jmjd6 T C 11: 116,842,500 Y117C probably damaging Het
Kbtbd4 T A 2: 90,909,291 V340E probably damaging Het
Kif26b T C 1: 178,928,306 V1995A probably damaging Het
Krt10 T C 11: 99,387,395 probably null Het
Macf1 T C 4: 123,432,281 D3022G probably benign Het
Map3k13 C T 16: 21,921,777 T618I probably benign Het
Mat1a G A 14: 41,121,422 V302M probably damaging Het
Med13l T C 5: 118,721,474 F242S probably damaging Het
Npffr2 A T 5: 89,583,012 K267M probably damaging Het
Nupl1 A T 14: 60,223,223 probably null Het
Papss2 A G 19: 32,663,148 Y440C possibly damaging Het
Ppil4 T A 10: 7,798,422 I110N probably damaging Het
Qrfpr G A 3: 36,180,265 T309I probably damaging Het
Rbl2 C A 8: 91,070,370 S65R probably benign Het
Rchy1 G A 5: 91,957,958 H44Y probably damaging Het
St7 C T 6: 17,852,314 A233V probably damaging Het
Syn2 T A 6: 115,281,098 S546T probably benign Het
Syne1 A T 10: 5,218,645 Y5245* probably null Het
Trmt6 A G 2: 132,812,153 W52R probably benign Het
Ubr4 G A 4: 139,414,394 V1264M probably damaging Het
Ulk4 A T 9: 121,141,894 V1004D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 T A 6: 124,192,410 H587L possibly damaging Het
Vmn2r79 A G 7: 87,003,533 R478G probably benign Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83022495 missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 83014812 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACCTTGTTCAAGCTCTGAGC -3'
(R):5'- GCTCTGGAAACATAGGGATCACC -3'

Sequencing Primer
(F):5'- TGAGCAGTTAACCCCTACTGAGATG -3'
(R):5'- GATCACCCTCGAATTGTGTGTAAG -3'
Posted On2018-06-06