Incidental Mutation 'R6546:Cdk18'
ID521164
Institutional Source Beutler Lab
Gene Symbol Cdk18
Ensembl Gene ENSMUSG00000026437
Gene Namecyclin-dependent kinase 18
SynonymsPctk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R6546 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132112237-132139684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132122350 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 29 (T29I)
Ref Sequence ENSEMBL: ENSMUSP00000107981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027697] [ENSMUST00000112362]
Predicted Effect probably damaging
Transcript: ENSMUST00000027697
AA Change: T29I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027697
Gene: ENSMUSG00000026437
AA Change: T29I

DomainStartEndE-ValueType
S_TKc 121 402 1.13e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112362
AA Change: T29I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107981
Gene: ENSMUSG00000026437
AA Change: T29I

DomainStartEndE-ValueType
S_TKc 121 402 1.13e-95 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,799,299 L242M probably damaging Het
Atad2b A T 12: 4,990,949 H206L probably damaging Het
Bmp2k A G 5: 97,088,078 Q1120R probably benign Het
Chrna3 T A 9: 55,015,901 I208F probably damaging Het
Dhrs1 G A 14: 55,741,272 P140S possibly damaging Het
Dnah14 C T 1: 181,738,987 R2775C probably damaging Het
Fam71e2 T C 7: 4,758,465 D416G probably benign Het
Fnip1 T G 11: 54,502,611 N600K probably benign Het
Jmjd6 T C 11: 116,842,500 Y117C probably damaging Het
Kbtbd4 T A 2: 90,909,291 V340E probably damaging Het
Kif26b T C 1: 178,928,306 V1995A probably damaging Het
Krt10 T C 11: 99,387,395 probably null Het
Macf1 T C 4: 123,432,281 D3022G probably benign Het
Map3k13 C T 16: 21,921,777 T618I probably benign Het
Mat1a G A 14: 41,121,422 V302M probably damaging Het
Med13l T C 5: 118,721,474 F242S probably damaging Het
Npffr2 A T 5: 89,583,012 K267M probably damaging Het
Nupl1 A T 14: 60,223,223 probably null Het
Papss2 A G 19: 32,663,148 Y440C possibly damaging Het
Ppil4 T A 10: 7,798,422 I110N probably damaging Het
Qrfpr G A 3: 36,180,265 T309I probably damaging Het
Rbl2 C A 8: 91,070,370 S65R probably benign Het
Rchy1 G A 5: 91,957,958 H44Y probably damaging Het
Slc19a3 T C 1: 83,026,360 T7A probably benign Het
St7 C T 6: 17,852,314 A233V probably damaging Het
Syn2 T A 6: 115,281,098 S546T probably benign Het
Syne1 A T 10: 5,218,645 Y5245* probably null Het
Trmt6 A G 2: 132,812,153 W52R probably benign Het
Ubr4 G A 4: 139,414,394 V1264M probably damaging Het
Ulk4 A T 9: 121,141,894 V1004D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 T A 6: 124,192,410 H587L possibly damaging Het
Vmn2r79 A G 7: 87,003,533 R478G probably benign Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Other mutations in Cdk18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cdk18 APN 1 132115488 missense probably benign 0.36
IGL00929:Cdk18 APN 1 132118519 critical splice donor site probably null
R0184:Cdk18 UTSW 1 132118538 missense probably benign 0.00
R0606:Cdk18 UTSW 1 132117617 unclassified probably benign
R0624:Cdk18 UTSW 1 132118872 missense probably damaging 1.00
R1295:Cdk18 UTSW 1 132119960 unclassified probably benign
R1296:Cdk18 UTSW 1 132119960 unclassified probably benign
R1298:Cdk18 UTSW 1 132122451 start gained probably benign
R1611:Cdk18 UTSW 1 132122375 missense probably damaging 1.00
R1959:Cdk18 UTSW 1 132117821 missense possibly damaging 0.95
R2184:Cdk18 UTSW 1 132115952 missense probably damaging 1.00
R2279:Cdk18 UTSW 1 132115952 missense probably damaging 1.00
R2391:Cdk18 UTSW 1 132115474 missense probably benign
R4601:Cdk18 UTSW 1 132116919 missense possibly damaging 0.95
R5001:Cdk18 UTSW 1 132118849 critical splice donor site probably null
R5208:Cdk18 UTSW 1 132117480 critical splice donor site probably null
R5818:Cdk18 UTSW 1 132119098 critical splice donor site probably null
R6282:Cdk18 UTSW 1 132120020 missense probably damaging 1.00
R6644:Cdk18 UTSW 1 132122069 nonsense probably null
R6892:Cdk18 UTSW 1 132122110 missense probably benign 0.01
R6965:Cdk18 UTSW 1 132117581 missense probably damaging 0.98
R7698:Cdk18 UTSW 1 132122378 missense probably damaging 1.00
R7828:Cdk18 UTSW 1 132116904 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGACTGAGTGGCATGTCTGAG -3'
(R):5'- GTCTGAGTGACCTAAGCATGCC -3'

Sequencing Primer
(F):5'- CTGAGTGGGACAAGTGTCAGTCC -3'
(R):5'- TGACCTAAGCATGCCCCGTG -3'
Posted On2018-06-06