Incidental Mutation 'R6546:Npffr2'
ID 521180
Institutional Source Beutler Lab
Gene Symbol Npffr2
Ensembl Gene ENSMUSG00000035528
Gene Name neuropeptide FF receptor 2
Synonyms Gpr74, NPFF2
MMRRC Submission 045325-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6546 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89675288-89731599 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89730871 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 267 (K267M)
Ref Sequence ENSEMBL: ENSMUSP00000040033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048557]
AlphaFold Q924H0
Predicted Effect probably damaging
Transcript: ENSMUST00000048557
AA Change: K267M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040033
Gene: ENSMUSG00000035528
AA Change: K267M

DomainStartEndE-ValueType
Pfam:7tm_4 52 349 3.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 347 3.7e-11 PFAM
Pfam:7tm_1 62 332 4.2e-57 PFAM
Meta Mutation Damage Score 0.7905 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,776,234 (GRCm39) L242M probably damaging Het
Atad2b A T 12: 5,040,949 (GRCm39) H206L probably damaging Het
Bmp2k A G 5: 97,235,937 (GRCm39) Q1120R probably benign Het
Cdk18 G A 1: 132,050,088 (GRCm39) T29I probably damaging Het
Chrna3 T A 9: 54,923,185 (GRCm39) I208F probably damaging Het
Dhrs1 G A 14: 55,978,729 (GRCm39) P140S possibly damaging Het
Dnah14 C T 1: 181,566,552 (GRCm39) R2775C probably damaging Het
Fnip1 T G 11: 54,393,437 (GRCm39) N600K probably benign Het
Garin5b T C 7: 4,761,464 (GRCm39) D416G probably benign Het
Jmjd6 T C 11: 116,733,326 (GRCm39) Y117C probably damaging Het
Kbtbd4 T A 2: 90,739,635 (GRCm39) V340E probably damaging Het
Kif26b T C 1: 178,755,871 (GRCm39) V1995A probably damaging Het
Krt10 T C 11: 99,278,221 (GRCm39) probably null Het
Macf1 T C 4: 123,326,074 (GRCm39) D3022G probably benign Het
Map3k13 C T 16: 21,740,527 (GRCm39) T618I probably benign Het
Mat1a G A 14: 40,843,379 (GRCm39) V302M probably damaging Het
Med13l T C 5: 118,859,539 (GRCm39) F242S probably damaging Het
Nup58 A T 14: 60,460,672 (GRCm39) probably null Het
Papss2 A G 19: 32,640,548 (GRCm39) Y440C possibly damaging Het
Ppil4 T A 10: 7,674,186 (GRCm39) I110N probably damaging Het
Qrfpr G A 3: 36,234,414 (GRCm39) T309I probably damaging Het
Rbl2 C A 8: 91,796,998 (GRCm39) S65R probably benign Het
Rchy1 G A 5: 92,105,817 (GRCm39) H44Y probably damaging Het
Slc19a3 T C 1: 83,004,081 (GRCm39) T7A probably benign Het
St7 C T 6: 17,852,313 (GRCm39) A233V probably damaging Het
Syn2 T A 6: 115,258,059 (GRCm39) S546T probably benign Het
Syne1 A T 10: 5,168,645 (GRCm39) Y5245* probably null Het
Trmt6 A G 2: 132,654,073 (GRCm39) W52R probably benign Het
Ubr4 G A 4: 139,141,705 (GRCm39) V1264M probably damaging Het
Ulk4 A T 9: 120,970,960 (GRCm39) V1004D probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r27 T A 6: 124,169,369 (GRCm39) H587L possibly damaging Het
Vmn2r79 A G 7: 86,652,741 (GRCm39) R478G probably benign Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Other mutations in Npffr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Npffr2 APN 5 89,730,831 (GRCm39) missense probably benign
IGL02308:Npffr2 APN 5 89,731,310 (GRCm39) missense probably benign 0.00
IGL02455:Npffr2 APN 5 89,715,994 (GRCm39) missense probably damaging 1.00
IGL03288:Npffr2 APN 5 89,731,020 (GRCm39) missense probably damaging 1.00
R0309:Npffr2 UTSW 5 89,731,206 (GRCm39) missense probably benign 0.00
R0389:Npffr2 UTSW 5 89,730,613 (GRCm39) missense probably benign 0.15
R1552:Npffr2 UTSW 5 89,730,975 (GRCm39) missense possibly damaging 0.45
R1736:Npffr2 UTSW 5 89,715,925 (GRCm39) missense probably damaging 1.00
R2015:Npffr2 UTSW 5 89,730,751 (GRCm39) missense probably damaging 0.99
R2127:Npffr2 UTSW 5 89,715,924 (GRCm39) missense probably damaging 1.00
R2129:Npffr2 UTSW 5 89,715,924 (GRCm39) missense probably damaging 1.00
R2429:Npffr2 UTSW 5 89,731,006 (GRCm39) missense probably damaging 1.00
R4272:Npffr2 UTSW 5 89,715,882 (GRCm39) missense probably damaging 1.00
R4740:Npffr2 UTSW 5 89,730,879 (GRCm39) nonsense probably null
R5023:Npffr2 UTSW 5 89,730,546 (GRCm39) missense probably benign 0.07
R6386:Npffr2 UTSW 5 89,730,556 (GRCm39) missense probably benign 0.02
R7735:Npffr2 UTSW 5 89,731,173 (GRCm39) missense probably benign
R7953:Npffr2 UTSW 5 89,730,513 (GRCm39) missense probably benign 0.24
R7998:Npffr2 UTSW 5 89,731,149 (GRCm39) missense probably damaging 0.99
R8043:Npffr2 UTSW 5 89,730,513 (GRCm39) missense probably benign 0.24
R8509:Npffr2 UTSW 5 89,731,188 (GRCm39) missense possibly damaging 0.78
R8799:Npffr2 UTSW 5 89,731,177 (GRCm39) missense probably benign 0.00
R9327:Npffr2 UTSW 5 89,730,661 (GRCm39) missense probably benign
X0039:Npffr2 UTSW 5 89,731,146 (GRCm39) missense probably benign 0.16
X0063:Npffr2 UTSW 5 89,715,844 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACTGGCCAAGACACGAAATG -3'
(R):5'- AAAGCATCTTGGAAACCATTGCG -3'

Sequencing Primer
(F):5'- TGAGGAGGATCTATACCACGGTG -3'
(R):5'- AATAATAGGGTTGACACTGCTGTTGC -3'
Posted On 2018-06-06