Mutagenetix > Incidental Mutation

Incidental Mutation 'R6546:Agbl3'

521190

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

045325-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6546 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34799299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 242 (L242M)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: L247M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: L247M

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: L242M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: L242M

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (35/35)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atad2b	A	T	12: 4,990,949	H206L	probably damaging	Het
Bmp2k	A	G	5: 97,088,078	Q1120R	probably benign	Het
Cdk18	G	A	1: 132,122,350	T29I	probably damaging	Het
Chrna3	T	A	9: 55,015,901	I208F	probably damaging	Het
Dhrs1	G	A	14: 55,741,272	P140S	possibly damaging	Het
Dnah14	C	T	1: 181,738,987	R2775C	probably damaging	Het
Fam71e2	T	C	7: 4,758,465	D416G	probably benign	Het
Fnip1	T	G	11: 54,502,611	N600K	probably benign	Het
Jmjd6	T	C	11: 116,842,500	Y117C	probably damaging	Het
Kbtbd4	T	A	2: 90,909,291	V340E	probably damaging	Het
Kif26b	T	C	1: 178,928,306	V1995A	probably damaging	Het
Krt10	T	C	11: 99,387,395		probably null	Het
Macf1	T	C	4: 123,432,281	D3022G	probably benign	Het
Map3k13	C	T	16: 21,921,777	T618I	probably benign	Het
Mat1a	G	A	14: 41,121,422	V302M	probably damaging	Het
Med13l	T	C	5: 118,721,474	F242S	probably damaging	Het
Npffr2	A	T	5: 89,583,012	K267M	probably damaging	Het
Nupl1	A	T	14: 60,223,223		probably null	Het
Papss2	A	G	19: 32,663,148	Y440C	possibly damaging	Het
Ppil4	T	A	10: 7,798,422	I110N	probably damaging	Het
Qrfpr	G	A	3: 36,180,265	T309I	probably damaging	Het
Rbl2	C	A	8: 91,070,370	S65R	probably benign	Het
Rchy1	G	A	5: 91,957,958	H44Y	probably damaging	Het
Slc19a3	T	C	1: 83,026,360	T7A	probably benign	Het
St7	C	T	6: 17,852,314	A233V	probably damaging	Het
Syn2	T	A	6: 115,281,098	S546T	probably benign	Het
Syne1	A	T	10: 5,218,645	Y5245*	probably null	Het
Trmt6	A	G	2: 132,812,153	W52R	probably benign	Het
Ubr4	G	A	4: 139,414,394	V1264M	probably damaging	Het
Ulk4	A	T	9: 121,141,894	V1004D	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r27	T	A	6: 124,192,410	H587L	possibly damaging	Het
Vmn2r79	A	G	7: 87,003,533	R478G	probably benign	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTATTAGTGCAGATCATGAATACG -3'
(R):5'- TCACTGTTGATGCCAGACAGG -3'

Sequencing Primer
(F):5'- AATACGAGTTGACTGTGCGCC -3'
(R):5'- CACTGTTGATGCCAGACAGGTATTC -3'

Posted On

2018-06-06