Incidental Mutation 'R6520:Zzef1'
ID 521191
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Name zinc finger, ZZ-type with EF hand domain 1
Synonyms C130099L13Rik, 8430405D05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6520 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 72796226-72927120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 72826065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 360 (N360K)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: N360K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: N360K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150551
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: N360K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: N360K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: N360K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik G T 2: 131,147,254 H111N probably damaging Het
1700093K21Rik T C 11: 23,517,285 D116G possibly damaging Het
Adam22 C T 5: 8,116,635 V699M probably damaging Het
Adh7 A G 3: 138,224,010 Y149C probably damaging Het
Angptl3 A C 4: 99,037,848 N405T probably benign Het
Ank3 A G 10: 69,988,387 H180R probably damaging Het
Apob T A 12: 7,983,124 I159N probably damaging Het
Arhgap24 T C 5: 102,880,793 V185A probably benign Het
Atf6 A T 1: 170,867,669 H11Q probably benign Het
Atxn3 C A 12: 101,934,401 D208Y probably damaging Het
Brd9 G A 13: 73,942,794 R273K probably benign Het
Cbfa2t3 T A 8: 122,635,801 R302W probably benign Het
Ccdc175 C A 12: 72,140,030 G347C probably damaging Het
Ccdc87 A G 19: 4,841,789 K770E probably damaging Het
Ccl17 T C 8: 94,810,550 F27L probably benign Het
Cd3g A T 9: 44,971,315 probably null Het
Cep350 A G 1: 155,933,336 V498A probably benign Het
Cfap45 A G 1: 172,540,584 D381G probably damaging Het
Cfap46 A G 7: 139,614,405 probably null Het
Cnrip1 T A 11: 17,078,536 M156K probably damaging Het
Col23a1 T C 11: 51,549,725 probably null Het
Col4a1 C T 8: 11,219,152 G933S probably damaging Het
Col5a3 C T 9: 20,774,052 V1443I unknown Het
Col6a6 T C 9: 105,785,825 E171G possibly damaging Het
Dennd1a A T 2: 37,961,747 probably null Het
Dlk2 C T 17: 46,302,512 T188I probably damaging Het
Dusp8 A G 7: 142,083,681 I203T probably damaging Het
Eno2 C T 6: 124,767,715 R56H probably damaging Het
Erich3 A T 3: 154,763,465 T1185S probably damaging Het
Evi5l A T 8: 4,205,906 Q575L possibly damaging Het
Fam187a T A 11: 102,885,875 H168Q possibly damaging Het
Fat2 T A 11: 55,284,988 E1633V probably damaging Het
Fbln2 G A 6: 91,259,659 D719N probably damaging Het
Fbn2 A T 18: 58,102,390 S672T probably damaging Het
Gas8 C G 8: 123,526,474 A187G probably benign Het
Gm2696 G A 10: 77,836,498 probably benign Het
Gnl1 A T 17: 35,982,953 K272M probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hemgn T G 4: 46,396,466 K257Q probably damaging Het
Hgsnat T C 8: 25,953,300 Y474C probably damaging Het
Hoxc4 T C 15: 103,034,954 S78P probably benign Het
Igkv14-100 T A 6: 68,519,234 L37Q probably damaging Het
Iqck A T 7: 118,941,631 K251M probably damaging Het
Itgal A T 7: 127,330,331 Q1140L probably benign Het
Itpka A G 2: 119,750,778 R431G probably benign Het
Jade1 A G 3: 41,604,482 N333D possibly damaging Het
Jmjd7 A G 2: 120,031,319 H181R probably damaging Het
Jmy A G 13: 93,454,039 S519P probably benign Het
Klra10 T A 6: 130,275,792 H173L probably benign Het
Krt72 T G 15: 101,781,046 I284L probably benign Het
Krt78 C A 15: 101,951,771 V237F probably benign Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Mcmbp A C 7: 128,712,727 V255G possibly damaging Het
Mcoln1 T G 8: 3,505,855 M50R probably damaging Het
Mocos T A 18: 24,666,390 V227E probably benign Het
Mpeg1 A G 19: 12,461,958 E260G probably benign Het
Mrc1 A T 2: 14,307,949 N894I probably damaging Het
Mroh7 A G 4: 106,721,263 S73P probably benign Het
Myo3a A T 2: 22,399,926 I690L possibly damaging Het
Naa50 T G 16: 44,159,509 F87V probably damaging Het
Ndufs6 G T 13: 73,328,352 T32K probably damaging Het
Nfe2l2 A G 2: 75,676,568 V396A probably benign Het
Nptn A G 9: 58,643,734 E348G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Olfr1083-ps A G 2: 86,607,118 L151P unknown Het
Olfr504 A G 7: 108,564,839 *319Q probably null Het
Olfr974 T C 9: 39,942,362 I34T possibly damaging Het
Plekha7 A G 7: 116,164,482 V233A probably benign Het
Polq C A 16: 37,060,377 Q968K possibly damaging Het
Prmt7 C T 8: 106,234,884 T143M probably damaging Het
Ptprc G A 1: 138,080,143 Q886* probably null Het
Rbp7 C A 4: 149,452,914 V36L possibly damaging Het
Rev3l A T 10: 39,822,702 N1065I probably benign Het
Scamp5 A T 9: 57,447,206 probably null Het
Sec16a A G 2: 26,426,106 S1698P probably damaging Het
Spr C A 6: 85,137,492 R85L probably benign Het
Sptlc2 A C 12: 87,355,662 N163K probably benign Het
Stk10 C T 11: 32,588,839 T226M probably damaging Het
Sv2c A G 13: 95,986,721 Y415H probably benign Het
Tet1 A G 10: 62,880,013 M1T probably null Het
Tnnt1 T A 7: 4,509,061 K150* probably null Het
Trappc10 C T 10: 78,201,453 V839M probably benign Het
Ubap2 T C 4: 41,195,155 N1131S probably damaging Het
Upk2 T C 9: 44,453,506 E132G probably damaging Het
Vmn2r117 A T 17: 23,460,219 V677D probably damaging Het
Vps13a A T 19: 16,725,579 L670H probably damaging Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zfp512 G A 5: 31,466,640 R67H probably damaging Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
R8874:Zzef1 UTSW 11 72863989 missense probably benign 0.00
R8885:Zzef1 UTSW 11 72796576 missense probably benign 0.00
R8972:Zzef1 UTSW 11 72900673 missense probably damaging 1.00
R8979:Zzef1 UTSW 11 72875177 missense probably benign 0.00
R9053:Zzef1 UTSW 11 72922476 missense probably benign
R9108:Zzef1 UTSW 11 72899778 missense probably benign 0.11
R9121:Zzef1 UTSW 11 72866120 nonsense probably null
R9370:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R9408:Zzef1 UTSW 11 72864827 missense possibly damaging 0.86
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72889182 missense probably benign
Z1187:Zzef1 UTSW 11 72889182 missense probably benign
Z1188:Zzef1 UTSW 11 72889182 missense probably benign
Z1189:Zzef1 UTSW 11 72889182 missense probably benign
Z1190:Zzef1 UTSW 11 72889182 missense probably benign
Z1191:Zzef1 UTSW 11 72889182 missense probably benign
Z1192:Zzef1 UTSW 11 72889182 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTCAGTGCTTTTGAGACAG -3'
(R):5'- AGTGACTTACTGAGTATTGTGCAGC -3'

Sequencing Primer
(F):5'- CAGTGCTTTTGAGACAGGTTAATTC -3'
(R):5'- ACTGAGTATTGTGCAGCACTGTC -3'
Posted On 2018-06-06