Incidental Mutation 'R6546:Fnip1'
ID521212
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R6546 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54502611 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 600 (N600K)
Ref Sequence ENSEMBL: ENSMUSP00000121399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
Predicted Effect probably benign
Transcript: ENSMUST00000046835
AA Change: N624K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: N624K

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143650
AA Change: N600K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: N600K

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,799,299 L242M probably damaging Het
Atad2b A T 12: 4,990,949 H206L probably damaging Het
Bmp2k A G 5: 97,088,078 Q1120R probably benign Het
Cdk18 G A 1: 132,122,350 T29I probably damaging Het
Chrna3 T A 9: 55,015,901 I208F probably damaging Het
Dhrs1 G A 14: 55,741,272 P140S possibly damaging Het
Dnah14 C T 1: 181,738,987 R2775C probably damaging Het
Fam71e2 T C 7: 4,758,465 D416G probably benign Het
Jmjd6 T C 11: 116,842,500 Y117C probably damaging Het
Kbtbd4 T A 2: 90,909,291 V340E probably damaging Het
Kif26b T C 1: 178,928,306 V1995A probably damaging Het
Krt10 T C 11: 99,387,395 probably null Het
Macf1 T C 4: 123,432,281 D3022G probably benign Het
Map3k13 C T 16: 21,921,777 T618I probably benign Het
Mat1a G A 14: 41,121,422 V302M probably damaging Het
Med13l T C 5: 118,721,474 F242S probably damaging Het
Npffr2 A T 5: 89,583,012 K267M probably damaging Het
Nupl1 A T 14: 60,223,223 probably null Het
Papss2 A G 19: 32,663,148 Y440C possibly damaging Het
Ppil4 T A 10: 7,798,422 I110N probably damaging Het
Qrfpr G A 3: 36,180,265 T309I probably damaging Het
Rbl2 C A 8: 91,070,370 S65R probably benign Het
Rchy1 G A 5: 91,957,958 H44Y probably damaging Het
Slc19a3 T C 1: 83,026,360 T7A probably benign Het
St7 C T 6: 17,852,314 A233V probably damaging Het
Syn2 T A 6: 115,281,098 S546T probably benign Het
Syne1 A T 10: 5,218,645 Y5245* probably null Het
Trmt6 A G 2: 132,812,153 W52R probably benign Het
Ubr4 G A 4: 139,414,394 V1264M probably damaging Het
Ulk4 A T 9: 121,141,894 V1004D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 T A 6: 124,192,410 H587L possibly damaging Het
Vmn2r79 A G 7: 87,003,533 R478G probably benign Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7949:Fnip1 UTSW 11 54465402 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTATGCCAGGCACAGTGATTAC -3'
(R):5'- TCTGACAACACACATTTGTCGG -3'

Sequencing Primer
(F):5'- GGCACAGTGATTACTACCACTTTAG -3'
(R):5'- CAACACACATTTGTCGGCTGGAG -3'
Posted On2018-06-06