Incidental Mutation 'R6546:Vmn2r111'
ID 521228
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 045325-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6546 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22778032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,776,234 (GRCm39) L242M probably damaging Het
Atad2b A T 12: 5,040,949 (GRCm39) H206L probably damaging Het
Bmp2k A G 5: 97,235,937 (GRCm39) Q1120R probably benign Het
Cdk18 G A 1: 132,050,088 (GRCm39) T29I probably damaging Het
Chrna3 T A 9: 54,923,185 (GRCm39) I208F probably damaging Het
Dhrs1 G A 14: 55,978,729 (GRCm39) P140S possibly damaging Het
Dnah14 C T 1: 181,566,552 (GRCm39) R2775C probably damaging Het
Fnip1 T G 11: 54,393,437 (GRCm39) N600K probably benign Het
Garin5b T C 7: 4,761,464 (GRCm39) D416G probably benign Het
Jmjd6 T C 11: 116,733,326 (GRCm39) Y117C probably damaging Het
Kbtbd4 T A 2: 90,739,635 (GRCm39) V340E probably damaging Het
Kif26b T C 1: 178,755,871 (GRCm39) V1995A probably damaging Het
Krt10 T C 11: 99,278,221 (GRCm39) probably null Het
Macf1 T C 4: 123,326,074 (GRCm39) D3022G probably benign Het
Map3k13 C T 16: 21,740,527 (GRCm39) T618I probably benign Het
Mat1a G A 14: 40,843,379 (GRCm39) V302M probably damaging Het
Med13l T C 5: 118,859,539 (GRCm39) F242S probably damaging Het
Npffr2 A T 5: 89,730,871 (GRCm39) K267M probably damaging Het
Nup58 A T 14: 60,460,672 (GRCm39) probably null Het
Papss2 A G 19: 32,640,548 (GRCm39) Y440C possibly damaging Het
Ppil4 T A 10: 7,674,186 (GRCm39) I110N probably damaging Het
Qrfpr G A 3: 36,234,414 (GRCm39) T309I probably damaging Het
Rbl2 C A 8: 91,796,998 (GRCm39) S65R probably benign Het
Rchy1 G A 5: 92,105,817 (GRCm39) H44Y probably damaging Het
Slc19a3 T C 1: 83,004,081 (GRCm39) T7A probably benign Het
St7 C T 6: 17,852,313 (GRCm39) A233V probably damaging Het
Syn2 T A 6: 115,258,059 (GRCm39) S546T probably benign Het
Syne1 A T 10: 5,168,645 (GRCm39) Y5245* probably null Het
Trmt6 A G 2: 132,654,073 (GRCm39) W52R probably benign Het
Ubr4 G A 4: 139,141,705 (GRCm39) V1264M probably damaging Het
Ulk4 A T 9: 120,970,960 (GRCm39) V1004D probably damaging Het
Vmn2r27 T A 6: 124,169,369 (GRCm39) H587L possibly damaging Het
Vmn2r79 A G 7: 86,652,741 (GRCm39) R478G probably benign Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GAGTAACTTAGGACAGAGATGt -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2018-06-06