Incidental Mutation 'R6521:Cdh20'
ID521241
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Namecadherin 20
SynonymsCdh7
MMRRC Submission
Accession Numbers

Genbank: NM_011800

Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location104768529-104995481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104942134 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 193 (D193A)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
Predicted Effect probably damaging
Transcript: ENSMUST00000062528
AA Change: D193A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: D193A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104953887 missense probably benign 0.05
IGL00743:Cdh20 APN 1 104947428 missense probably benign 0.06
IGL00848:Cdh20 APN 1 104934256 missense probably benign
IGL01393:Cdh20 APN 1 104934244 missense probably benign
IGL01396:Cdh20 APN 1 104947429 missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104934107 missense probably benign 0.05
IGL01612:Cdh20 APN 1 104994170 missense probably benign 0.02
IGL01947:Cdh20 APN 1 104993924 missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104941037 missense probably damaging 1.00
IGL02226:Cdh20 APN 1 104954091 splice site probably benign
IGL02318:Cdh20 APN 1 104954039 missense probably null 0.03
IGL02326:Cdh20 APN 1 104975039 missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104947465 missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104934098 start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104941257 missense probably damaging 1.00
3-1:Cdh20 UTSW 1 104947420 missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
IGL02991:Cdh20 UTSW 1 104934247 missense probably benign
R0178:Cdh20 UTSW 1 104975051 missense possibly damaging 0.82
R1114:Cdh20 UTSW 1 104979014 missense probably damaging 0.96
R1401:Cdh20 UTSW 1 104947497 missense possibly damaging 0.65
R1502:Cdh20 UTSW 1 104954030 missense probably benign 0.06
R1764:Cdh20 UTSW 1 104934345 splice site probably benign
R2198:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104947414 missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104975015 missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104947474 missense probably damaging 1.00
R4243:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4349:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104934310 missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104984685 missense probably damaging 0.99
R4795:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104984803 missense probably damaging 1.00
R5056:Cdh20 UTSW 1 104953997 missense probably benign 0.00
R5127:Cdh20 UTSW 1 104947348 missense probably damaging 1.00
R5269:Cdh20 UTSW 1 104934157 missense possibly damaging 0.67
R5563:Cdh20 UTSW 1 104947357 missense probably benign 0.29
R5634:Cdh20 UTSW 1 104975075 missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104984910 missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104934098 start codon destroyed probably null 0.49
R5933:Cdh20 UTSW 1 104984671 missense probably damaging 1.00
R6109:Cdh20 UTSW 1 104994014 missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104984686 missense possibly damaging 0.95
R7169:Cdh20 UTSW 1 104947353 missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104993977 missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104954071 missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104970873 missense probably benign
R7535:Cdh20 UTSW 1 104975043 missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104941279 missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104941299 missense probably damaging 1.00
R7879:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R7925:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
R8257:Cdh20 UTSW 1 104994237 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCCTATTGAGTAACAAAATGGGAGTC -3'
(R):5'- CCTGTCCAATATGCTCCATGG -3'

Sequencing Primer
(F):5'- ATGGGAGTCATGGAATCGTGATC -3'
(R):5'- GTCCAATATGCTCCATGGAGAGTC -3'
Posted On2018-06-06