Mutagenetix > Incidental Mutations

Incidental Mutation 'R6547:Scn2a'

521242

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6547 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65715897 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 935 (I935V)

Ref Sequence

ENSEMBL: ENSMUSP00000143882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829] [ENSMUST00000202508]

Predicted Effect

probably benign
Transcript: ENSMUST00000028377
AA Change: I935V

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: I935V

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100067
AA Change: I935V

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: I935V

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200829
AA Change: I935V

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: I935V

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202162

Predicted Effect

probably benign
Transcript: ENSMUST00000202508

SMART Domains

Protein: ENSMUSP00000143958
Gene: ENSMUSG00000075318

Domain	Start	End	E-Value	Type
Pfam:Na_trans_assoc	1	106	1.9e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,659,907		probably benign	Het
9230113P08Rik	T	A	9: 35,908,485	M15K	probably null	Het
Abca13	T	A	11: 9,274,757	V490E	probably benign	Het
Abca2	G	T	2: 25,433,338	G106V	possibly damaging	Het
Ablim3	T	C	18: 61,823,929	T276A	probably benign	Het
Anxa7	A	G	14: 20,469,393	V119A	probably benign	Het
Arl9	A	G	5: 77,010,410		probably null	Het
Atm	T	C	9: 53,440,157	Y2964C	probably damaging	Het
Bbs9	T	C	9: 22,514,069	Y140H	probably benign	Het
Calcr	A	T	6: 3,717,177	D94E	probably damaging	Het
Celsr3	T	A	9: 108,829,128	Y937N	probably damaging	Het
Clca3a1	C	T	3: 144,736,947	A779T	probably damaging	Het
Clec9a	T	A	6: 129,416,376	V94D	probably benign	Het
Colec12	G	T	18: 9,840,351	L57F	probably damaging	Het
Fa2h	T	C	8: 111,348,020	Y317C	probably damaging	Het
Fam126a	T	C	5: 23,965,100	N417S	probably benign	Het
Flnc	A	G	6: 29,448,608	T1282A	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Hcn2	G	T	10: 79,717,152	V162L	probably benign	Het
Kbtbd11	T	A	8: 15,027,641	V80E	possibly damaging	Het
Lama4	A	G	10: 39,073,656	D915G	probably damaging	Het
Limch1	A	T	5: 67,028,774	E806V	probably damaging	Het
Mppe1	T	C	18: 67,228,988	I169V	probably benign	Het
Msc	A	C	1: 14,755,745	S2A	possibly damaging	Het
Nploc4	A	G	11: 120,428,522		probably null	Het
Nr3c2	A	T	8: 76,908,809	I180F	possibly damaging	Het
Nrap	G	T	19: 56,351,566	H840N	probably benign	Het
Olfr151	T	A	9: 37,730,495	M163L	probably benign	Het
Pdlim1	G	A	19: 40,223,120	T243I	probably damaging	Het
Pfkl	T	A	10: 77,995,354	M318L	probably benign	Het
Rap1gds1	C	A	3: 138,955,338	R426L	probably damaging	Het
Ric1	A	G	19: 29,594,826	N674D	probably damaging	Het
Rp1	G	A	1: 4,170,305	T875I	unknown	Het
Rtn1	G	T	12: 72,308,761	S137Y	possibly damaging	Het
Serpina1a	C	T	12: 103,855,921	V251M	probably damaging	Het
Slc19a3	A	G	1: 83,022,900	V132A	probably damaging	Het
Slc26a6	T	A	9: 108,860,782		probably null	Het
Slc2a5	T	A	4: 150,135,619	V164D	possibly damaging	Het
Slc4a1	T	A	11: 102,356,735	T441S	probably damaging	Het
Stk33	T	C	7: 109,320,835	I366V	possibly damaging	Het
Syt14	G	T	1: 192,901,869	H696N	possibly damaging	Het
Tcaim	T	A	9: 122,814,466	V77D	probably benign	Het
Tefm	T	G	11: 80,140,384		probably null	Het
Tekt3	T	A	11: 63,070,478	S158T	possibly damaging	Het
Tmem2	A	T	19: 21,844,831	T1197S	probably benign	Het
Tspan11	T	A	6: 127,949,803	M238K	possibly damaging	Het
Unc5c	A	T	3: 141,790,019	T476S	probably benign	Het
Usp9y	A	T	Y: 1,444,612	L109Q	probably damaging	Homo
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vps13c	C	A	9: 67,973,365	Q3495K	probably damaging	Het
Zbtb10	G	A	3: 9,251,703	A192T	probably benign	Het
Zfp316	A	T	5: 143,254,197	V689D	probably damaging	Het
Zswim1	A	G	2: 164,824,796		probably benign	Het
Zswim5	T	C	4: 116,986,903	L1046P	probably damaging	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1386:Scn2a	UTSW	2	65688741	missense	probably damaging	1.00
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1642:Scn2a	UTSW	2	65683697	missense	probably damaging	1.00
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5161:Scn2a	UTSW	2	65764591	missense	probably benign	0.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6818:Scn2a	UTSW	2	65688669	nonsense	probably null
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7179:Scn2a	UTSW	2	65701979	missense	probably damaging	1.00
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7695:Scn2a	UTSW	2	65711907	missense	probably damaging	0.99
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- AAGATCATCGGCAACTCGGTG -3'
(R):5'- GCTATGGCTCCTGAAATCTGATG -3'

Sequencing Primer
(F):5'- CAGCTGTTTGGAAAGAGC -3'
(R):5'- GGCTCCTGAAATCTGATGTTAAAGAC -3'

Posted On

2018-06-06