Incidental Mutation 'R6521:Olfr1018'
ID521249
Institutional Source Beutler Lab
Gene Symbol Olfr1018
Ensembl Gene ENSMUSG00000043892
Gene Nameolfactory receptor 1018
SynonymsGA_x6K02T2Q125-47301584-47302519, MOR260-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85818479-85824221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85823450 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 160 (I160F)
Ref Sequence ENSEMBL: ENSMUSP00000151090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054201] [ENSMUST00000214416]
Predicted Effect probably benign
Transcript: ENSMUST00000054201
AA Change: I160F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000050833
Gene: ENSMUSG00000043892
AA Change: I160F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 4.1e-59 PFAM
Pfam:7tm_1 42 291 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214416
AA Change: I160F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Olfr1018
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Olfr1018 APN 2 85822988 missense probably benign 0.00
IGL02795:Olfr1018 APN 2 85823512 nonsense probably null
IGL03189:Olfr1018 APN 2 85823558 missense probably benign 0.27
IGL03329:Olfr1018 APN 2 85823385 missense probably benign 0.02
IGL03400:Olfr1018 APN 2 85823750 missense probably damaging 1.00
IGL02796:Olfr1018 UTSW 2 85823589 missense probably benign 0.00
R5322:Olfr1018 UTSW 2 85823187 missense probably damaging 0.99
R5597:Olfr1018 UTSW 2 85823460 missense probably damaging 0.96
R6725:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
R7068:Olfr1018 UTSW 2 85823052 missense probably benign 0.00
R7105:Olfr1018 UTSW 2 85823880 missense probably benign 0.22
R8011:Olfr1018 UTSW 2 85823613 missense possibly damaging 0.90
Z1176:Olfr1018 UTSW 2 85823021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCACGCAGATGTATTTC -3'
(R):5'- ATCGCATCCTGAGAACAGAAAG -3'

Sequencing Primer
(F):5'- GCCACGCAGATGTATTTCTCACTC -3'
(R):5'- CATCCTGAGAACAGAAAGAAGGATGC -3'
Posted On2018-06-06