Incidental Mutation 'R6547:Zbtb10'
ID521250
Institutional Source Beutler Lab
Gene Symbol Zbtb10
Ensembl Gene ENSMUSG00000069114
Gene Namezinc finger and BTB domain containing 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R6547 (G1)
Quality Score181.009
Status Validated
Chromosome3
Chromosomal Location9250602-9285333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9251703 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 192 (A192T)
Ref Sequence ENSEMBL: ENSMUSP00000119386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155203]
Predicted Effect probably benign
Transcript: ENSMUST00000155203
AA Change: A192T

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119386
Gene: ENSMUSG00000069114
AA Change: A192T

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 75 82 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 180 222 N/A INTRINSIC
ZnF_TTF 239 321 7.92e-2 SMART
BTB 357 456 4.02e-20 SMART
internal_repeat_1 648 671 2.82e-12 PROSPERO
internal_repeat_1 672 695 2.82e-12 PROSPERO
ZnF_C2H2 714 736 6.78e-3 SMART
ZnF_C2H2 742 764 2.09e-3 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Zbtb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Zbtb10 APN 3 9251812 missense probably damaging 0.96
IGL02207:Zbtb10 APN 3 9280465 critical splice donor site probably null
IGL02499:Zbtb10 APN 3 9251740 missense probably damaging 1.00
IGL02506:Zbtb10 APN 3 9265237 missense probably damaging 0.99
IGL03294:Zbtb10 APN 3 9280987 missense probably benign 0.18
R0510:Zbtb10 UTSW 3 9264668 missense probably damaging 1.00
R1859:Zbtb10 UTSW 3 9280386 missense possibly damaging 0.47
R2342:Zbtb10 UTSW 3 9265195 missense possibly damaging 0.60
R3407:Zbtb10 UTSW 3 9264866 missense probably damaging 1.00
R4161:Zbtb10 UTSW 3 9280296 missense probably damaging 1.00
R4301:Zbtb10 UTSW 3 9265160 missense probably damaging 0.96
R4698:Zbtb10 UTSW 3 9264550 missense possibly damaging 0.87
R5184:Zbtb10 UTSW 3 9264671 missense probably damaging 0.99
R5443:Zbtb10 UTSW 3 9280048 missense probably benign
R5665:Zbtb10 UTSW 3 9265192 missense probably damaging 0.99
R5744:Zbtb10 UTSW 3 9264563 missense probably damaging 1.00
R5862:Zbtb10 UTSW 3 9265216 missense probably damaging 0.98
R5909:Zbtb10 UTSW 3 9280049 missense probably benign 0.14
R6612:Zbtb10 UTSW 3 9252065 missense possibly damaging 0.87
R7457:Zbtb10 UTSW 3 9251478 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAAGGAACCGTCGGACTCTG -3'
(R):5'- GAAGTCCTTGAGCCAAGAGGTC -3'

Sequencing Primer
(F):5'- GGGTCTCGGCAACAATGG -3'
(R):5'- CTGGAAGGAGCACTGGAGCTTC -3'
Posted On2018-06-06