Incidental Mutation 'R6547:Zswim5'
ID521258
Institutional Source Beutler Lab
Gene Symbol Zswim5
Ensembl Gene ENSMUSG00000033948
Gene Namezinc finger SWIM-type containing 5
Synonyms4933426E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116877376-116989264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116986903 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1046 (L1046P)
Ref Sequence ENSEMBL: ENSMUSP00000049474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000044823] [ENSMUST00000130273]
Predicted Effect probably benign
Transcript: ENSMUST00000030446
SMART Domains Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 14 360 2.4e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044823
AA Change: L1046P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049474
Gene: ENSMUSG00000033948
AA Change: L1046P

DomainStartEndE-ValueType
low complexity region 35 56 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
low complexity region 692 708 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130273
SMART Domains Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 1 64 1.2e-18 PFAM
Pfam:URO-D 60 120 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Other mutations in Zswim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Zswim5 APN 4 116985736 missense possibly damaging 0.93
IGL01700:Zswim5 APN 4 116986461 unclassified probably benign
IGL01975:Zswim5 APN 4 116965692 missense probably benign 0.03
IGL02334:Zswim5 APN 4 116986644 missense probably damaging 1.00
IGL02505:Zswim5 APN 4 116962552 missense probably benign 0.43
IGL02712:Zswim5 APN 4 116985695 missense probably damaging 0.99
PIT4243001:Zswim5 UTSW 4 116984778 missense probably benign 0.10
R0324:Zswim5 UTSW 4 116986906 missense probably damaging 1.00
R0611:Zswim5 UTSW 4 116986677 unclassified probably null
R0730:Zswim5 UTSW 4 116985746 missense possibly damaging 0.75
R1663:Zswim5 UTSW 4 116986895 missense probably damaging 1.00
R1843:Zswim5 UTSW 4 116877699 missense unknown
R2070:Zswim5 UTSW 4 116979912 missense probably benign 0.14
R2176:Zswim5 UTSW 4 116973041 missense probably damaging 0.99
R3715:Zswim5 UTSW 4 116962558 missense probably benign 0.21
R4044:Zswim5 UTSW 4 116986702 missense probably damaging 1.00
R4063:Zswim5 UTSW 4 116877980 missense unknown
R4118:Zswim5 UTSW 4 116986819 missense possibly damaging 0.93
R4612:Zswim5 UTSW 4 116986704 missense probably damaging 1.00
R4782:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4799:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4983:Zswim5 UTSW 4 116985686 missense possibly damaging 0.60
R5294:Zswim5 UTSW 4 116979577 missense possibly damaging 0.93
R5836:Zswim5 UTSW 4 116984803 missense probably benign 0.27
R6025:Zswim5 UTSW 4 116950909 missense probably damaging 1.00
R6041:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6042:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6043:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6159:Zswim5 UTSW 4 116979679 missense probably damaging 1.00
R6198:Zswim5 UTSW 4 116878007 missense probably benign 0.13
R6415:Zswim5 UTSW 4 116980866 missense possibly damaging 0.89
R6442:Zswim5 UTSW 4 116951005 missense probably damaging 1.00
R6616:Zswim5 UTSW 4 116986741 missense possibly damaging 0.93
R6745:Zswim5 UTSW 4 116975204 missense probably damaging 1.00
R7144:Zswim5 UTSW 4 116975976 critical splice donor site probably null
R7260:Zswim5 UTSW 4 116962646 missense probably damaging 1.00
R7300:Zswim5 UTSW 4 116975905 missense probably damaging 1.00
R7310:Zswim5 UTSW 4 116984688 missense probably benign 0.01
R7326:Zswim5 UTSW 4 116980834 missense possibly damaging 0.75
R7429:Zswim5 UTSW 4 116975857 missense possibly damaging 0.87
R7430:Zswim5 UTSW 4 116975857 missense possibly damaging 0.87
R7607:Zswim5 UTSW 4 116986742 missense possibly damaging 0.93
R7811:Zswim5 UTSW 4 116877476 missense unknown
Predicted Primers PCR Primer
(F):5'- TACCAGATTGCCATTGATGCTG -3'
(R):5'- TGATGGTTGCATCCAGTAGC -3'

Sequencing Primer
(F):5'- GCCATTGATGCTGCTGCC -3'
(R):5'- CTGTTGACATGAGCTTTCCG -3'
Posted On2018-06-06