Incidental Mutation 'R6521:Mmd2'
ID521261
Institutional Source Beutler Lab
Gene Symbol Mmd2
Ensembl Gene ENSMUSG00000039533
Gene Namemonocyte to macrophage differentiation-associated 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6521 (G1)
Quality Score208.009
Status Not validated
Chromosome5
Chromosomal Location142562358-142608800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142574830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000039357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037048]
Predicted Effect probably damaging
Transcript: ENSMUST00000037048
AA Change: I112T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039357
Gene: ENSMUSG00000039533
AA Change: I112T

DomainStartEndE-ValueType
Pfam:HlyIII 33 228 5.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PAQR (progestin and adipoQ receptor) family. Members of this family are evolutionarily conserved with significant sequence identity to bacterial hemolysin-like proteins and are defined by a set of seven transmembrane domains. The protein encoded by this gene localizes to the Golgi apparatus to modulate Ras signaling. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Mmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Mmd2 APN 5 142575229 missense probably damaging 1.00
IGL02221:Mmd2 APN 5 142569457 splice site probably benign
IGL02432:Mmd2 APN 5 142575339 missense probably damaging 1.00
IGL02964:Mmd2 APN 5 142569477 missense probably damaging 1.00
IGL03333:Mmd2 APN 5 142567938 splice site probably benign
R0615:Mmd2 UTSW 5 142564913 missense probably benign 0.04
R1717:Mmd2 UTSW 5 142575350 splice site probably benign
R2034:Mmd2 UTSW 5 142575184 critical splice donor site probably null
R3981:Mmd2 UTSW 5 142564799 missense probably damaging 1.00
R3982:Mmd2 UTSW 5 142564799 missense probably damaging 1.00
R4501:Mmd2 UTSW 5 142575210 missense probably benign 0.00
R6103:Mmd2 UTSW 5 142567863 critical splice donor site probably null
R7222:Mmd2 UTSW 5 142567927 missense probably benign 0.04
R7244:Mmd2 UTSW 5 142564832 missense probably damaging 1.00
R7579:Mmd2 UTSW 5 142608606 start codon destroyed probably null 0.02
R7997:Mmd2 UTSW 5 142574860 missense possibly damaging 0.67
X0024:Mmd2 UTSW 5 142575244 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCATATACACAGACATTCACACTTG -3'
(R):5'- AGTTCTCTCTACAGGGTGGG -3'

Sequencing Primer
(F):5'- GAAGGATACACTAGGTAATTCTTGGC -3'
(R):5'- CTCTCTACAGGGTGGGGTAGTG -3'
Posted On2018-06-06