Incidental Mutation 'R6521:Mkln1'
ID 521263
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R6521 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31490544 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 64 (D64E)
Ref Sequence ENSEMBL: ENSMUSP00000123048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699] [ENSMUST00000130108]
AlphaFold O89050
Predicted Effect probably damaging
Transcript: ENSMUST00000026699
AA Change: D592E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: D592E

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130108
AA Change: D64E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123048
Gene: ENSMUSG00000025609
AA Change: D64E

DomainStartEndE-ValueType
SCOP:d1k3ia3 1 93 8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150949
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense not run
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATTGGCAGTTAACTTACTGG -3'
(R):5'- GTGTCACGAATTATGGACCATAC -3'

Sequencing Primer
(F):5'- ATTGGCAGTTAACTTACTGGTTTTAG -3'
(R):5'- AGGCATCCTGGGCAATTTAC -3'
Posted On 2018-06-06