Incidental Mutation 'R6521:Aars1'
ID 521278
Institutional Source Beutler Lab
Gene Symbol Aars1
Ensembl Gene ENSMUSG00000031960
Gene Name alanyl-tRNA synthetase 1
Synonyms Aars
MMRRC Submission 044647-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R6521 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111759781-111784237 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111769968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 356 (S356T)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441]
AlphaFold Q8BGQ7
Predicted Effect probably benign
Transcript: ENSMUST00000034441
AA Change: S356T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: S356T

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174930
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 57,168,565 (GRCm39) M185V probably benign Het
Adgrv1 A T 13: 81,581,771 (GRCm39) F4758I probably damaging Het
Ank3 A G 10: 69,828,596 (GRCm39) probably benign Het
Ankfy1 G A 11: 72,621,308 (GRCm39) R198Q possibly damaging Het
Ano4 A G 10: 88,819,640 (GRCm39) V537A probably damaging Het
Catsper2 A G 2: 121,237,288 (GRCm39) L204P probably damaging Het
Cdh20 A C 1: 104,869,859 (GRCm39) D193A probably damaging Het
Ceacam5 T C 7: 17,484,756 (GRCm39) probably null Het
Celf4 T A 18: 25,612,531 (GRCm39) probably null Het
Cfap91 A G 16: 38,127,121 (GRCm39) V545A probably benign Het
Crebbp A T 16: 3,936,992 (GRCm39) F754I probably damaging Het
Cyfip2 A T 11: 46,145,415 (GRCm39) I635N probably damaging Het
Erbb4 T A 1: 68,081,689 (GRCm39) D1131V probably damaging Het
Fsip2 A G 2: 82,820,430 (GRCm39) T5388A possibly damaging Het
Hoxc8 G A 15: 102,901,135 (GRCm39) V193M probably benign Het
Klhdc3 A G 17: 46,988,687 (GRCm39) V124A probably benign Het
Klhl18 A G 9: 110,257,703 (GRCm39) I509T possibly damaging Het
Mdfic T A 6: 15,729,027 (GRCm39) probably benign Het
Mkln1 T A 6: 31,467,479 (GRCm39) D64E probably damaging Het
Mmd2 A G 5: 142,560,585 (GRCm39) I112T probably damaging Het
Mpl C T 4: 118,312,314 (GRCm39) probably null Het
Mtmr4 A G 11: 87,504,353 (GRCm39) T1044A possibly damaging Het
Muc5b C A 7: 141,412,908 (GRCm39) Y1951* probably null Het
Myo15a C T 11: 60,393,195 (GRCm39) H2240Y probably damaging Het
Nckap5 A T 1: 126,309,909 (GRCm39) I74K probably damaging Het
Nfxl1 A T 5: 72,697,651 (GRCm39) probably null Het
Or11j4 T C 14: 50,631,005 (GRCm39) V264A possibly damaging Het
Or2ah1 A T 2: 85,653,794 (GRCm39) I160F probably benign Het
Or4c11c A G 2: 88,661,700 (GRCm39) I80V probably benign Het
Or8d2 C T 9: 38,759,893 (GRCm39) T161I probably benign Het
Piezo2 T C 18: 63,154,399 (GRCm39) Y2460C probably damaging Het
Pigx A G 16: 31,906,129 (GRCm39) L64P probably damaging Het
Prss1 C T 6: 41,440,615 (GRCm39) T230I probably damaging Het
Ptma A G 1: 86,455,569 (GRCm39) probably null Het
Rab39 T C 9: 53,617,331 (GRCm39) T29A probably benign Het
Rem2 C T 14: 54,715,144 (GRCm39) A107V possibly damaging Het
Senp1 A G 15: 97,946,152 (GRCm39) V531A probably damaging Het
Serhl A G 15: 82,985,843 (GRCm39) probably null Het
Sirpa T G 2: 129,472,075 (GRCm39) Y164D probably damaging Het
Slc12a3 T C 8: 95,069,741 (GRCm39) I550T possibly damaging Het
Slc22a14 T C 9: 119,049,835 (GRCm39) probably null Het
Slfn5 A G 11: 82,851,241 (GRCm39) N513D probably damaging Het
Sptan1 T C 2: 29,910,467 (GRCm39) S1831P possibly damaging Het
Swap70 T C 7: 109,855,027 (GRCm39) L109P probably benign Het
Tas2r119 G A 15: 32,178,319 (GRCm39) C295Y probably damaging Het
Tcaf3 T A 6: 42,570,172 (GRCm39) I527L probably damaging Het
Traj31 A G 14: 54,425,387 (GRCm39) probably benign Het
Unc5a T A 13: 55,152,748 (GRCm39) D887E probably benign Het
Zfp407 T A 18: 84,450,536 (GRCm39) H1600L probably damaging Het
Other mutations in Aars1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars1 APN 8 111,774,604 (GRCm39) missense possibly damaging 0.86
IGL00731:Aars1 APN 8 111,771,501 (GRCm39) splice site probably benign
IGL00826:Aars1 APN 8 111,766,932 (GRCm39) missense probably damaging 1.00
IGL01521:Aars1 APN 8 111,770,419 (GRCm39) missense possibly damaging 0.85
IGL01885:Aars1 APN 8 111,774,575 (GRCm39) missense possibly damaging 0.89
IGL01920:Aars1 APN 8 111,769,878 (GRCm39) missense probably damaging 1.00
IGL01934:Aars1 APN 8 111,774,650 (GRCm39) missense probably damaging 0.98
IGL02013:Aars1 APN 8 111,773,698 (GRCm39) missense probably damaging 0.99
IGL02489:Aars1 APN 8 111,780,847 (GRCm39) unclassified probably benign
IGL02683:Aars1 APN 8 111,779,163 (GRCm39) unclassified probably benign
IGL03084:Aars1 APN 8 111,768,261 (GRCm39) missense probably damaging 1.00
H8786:Aars1 UTSW 8 111,772,187 (GRCm39) missense probably benign
R0037:Aars1 UTSW 8 111,769,891 (GRCm39) missense possibly damaging 0.77
R0049:Aars1 UTSW 8 111,779,083 (GRCm39) missense possibly damaging 0.75
R0049:Aars1 UTSW 8 111,779,083 (GRCm39) missense possibly damaging 0.75
R0577:Aars1 UTSW 8 111,769,910 (GRCm39) missense probably benign 0.10
R1183:Aars1 UTSW 8 111,768,206 (GRCm39) nonsense probably null
R1642:Aars1 UTSW 8 111,769,882 (GRCm39) missense possibly damaging 0.77
R1829:Aars1 UTSW 8 111,769,338 (GRCm39) missense probably damaging 1.00
R1857:Aars1 UTSW 8 111,766,789 (GRCm39) missense probably damaging 0.99
R2190:Aars1 UTSW 8 111,766,785 (GRCm39) missense probably damaging 1.00
R2303:Aars1 UTSW 8 111,779,134 (GRCm39) missense possibly damaging 0.84
R3918:Aars1 UTSW 8 111,766,774 (GRCm39) missense probably damaging 1.00
R4001:Aars1 UTSW 8 111,768,234 (GRCm39) missense probably damaging 1.00
R4434:Aars1 UTSW 8 111,781,253 (GRCm39) missense probably null 0.74
R4909:Aars1 UTSW 8 111,781,715 (GRCm39) missense probably damaging 1.00
R4970:Aars1 UTSW 8 111,770,311 (GRCm39) missense probably benign 0.00
R5639:Aars1 UTSW 8 111,769,866 (GRCm39) missense probably benign 0.01
R5991:Aars1 UTSW 8 111,777,032 (GRCm39) missense probably damaging 1.00
R6403:Aars1 UTSW 8 111,768,881 (GRCm39) missense possibly damaging 0.87
R6956:Aars1 UTSW 8 111,781,762 (GRCm39) missense probably benign 0.38
R7378:Aars1 UTSW 8 111,768,974 (GRCm39) missense probably damaging 1.00
R7625:Aars1 UTSW 8 111,773,587 (GRCm39) missense probably damaging 0.99
R7745:Aars1 UTSW 8 111,768,289 (GRCm39) missense probably damaging 1.00
R7792:Aars1 UTSW 8 111,769,896 (GRCm39) missense possibly damaging 0.75
R7860:Aars1 UTSW 8 111,776,493 (GRCm39) missense probably benign 0.16
R8109:Aars1 UTSW 8 111,767,284 (GRCm39) missense probably benign
R8197:Aars1 UTSW 8 111,780,628 (GRCm39) missense probably benign 0.44
R8322:Aars1 UTSW 8 111,772,160 (GRCm39) missense possibly damaging 0.93
R8343:Aars1 UTSW 8 111,767,361 (GRCm39) missense probably damaging 1.00
R8683:Aars1 UTSW 8 111,768,881 (GRCm39) missense possibly damaging 0.87
R8783:Aars1 UTSW 8 111,776,515 (GRCm39) missense probably benign 0.01
R8977:Aars1 UTSW 8 111,766,849 (GRCm39) missense probably damaging 1.00
R9087:Aars1 UTSW 8 111,768,169 (GRCm39) missense probably damaging 1.00
R9401:Aars1 UTSW 8 111,780,785 (GRCm39) missense probably benign 0.24
R9561:Aars1 UTSW 8 111,763,615 (GRCm39) missense probably damaging 1.00
R9576:Aars1 UTSW 8 111,768,296 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTTTAAAGGAGCTCCCGTGG -3'
(R):5'- GCTATTCCGTGAAACACCCTC -3'

Sequencing Primer
(F):5'- TGGGCCCCTCAGCTAGG -3'
(R):5'- CTTACACAGTGCAGATCAGGCTG -3'
Posted On 2018-06-06