Incidental Mutation 'R6547:Bbs9'
ID521283
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene NameBardet-Biedl syndrome 9 (human)
SynonymsE130103I17Rik, EST 3159894
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location22475715-22888280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22514069 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 140 (Y140H)
Ref Sequence ENSEMBL: ENSMUSP00000116629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000128812] [ENSMUST00000142313] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
Predicted Effect probably benign
Transcript: ENSMUST00000039798
AA Change: Y140H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128812
AA Change: Y140H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117700
Gene: ENSMUSG00000035919
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 147 2.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142313
SMART Domains Protein: ENSMUSP00000122325
Gene: ENSMUSG00000035919

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 132 2.6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147405
AA Change: Y140H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147712
AA Change: Y140H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150395
AA Change: Y140H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152719
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22887683 missense probably benign 0.00
IGL01586:Bbs9 APN 9 22645997 missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22670925 nonsense probably null
IGL01654:Bbs9 APN 9 22490942 critical splice donor site probably null
IGL02172:Bbs9 APN 9 22579476 missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22812512 missense probably benign 0.02
IGL02444:Bbs9 APN 9 22643787 missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22579484 missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22643748 missense probably benign 0.19
corpulent UTSW 9 22575196 critical splice donor site probably null
Crapulence UTSW 9 22567764 missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22504094 missense probably benign 0.30
R0243:Bbs9 UTSW 9 22514001 missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22496815 missense probably benign
R0688:Bbs9 UTSW 9 22567719 missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22793823 missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22575201 splice site probably null
R0783:Bbs9 UTSW 9 22567714 missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22575100 splice site probably benign
R1532:Bbs9 UTSW 9 22887649 missense probably benign 0.00
R1783:Bbs9 UTSW 9 22659119 missense possibly damaging 0.85
R2285:Bbs9 UTSW 9 22678934 missense probably damaging 1.00
R2402:Bbs9 UTSW 9 22646063 missense probably benign 0.23
R2655:Bbs9 UTSW 9 22504052 missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22567887 splice site probably benign
R3798:Bbs9 UTSW 9 22638769 missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22887630 missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22578767 missense probably benign 0.16
R4873:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R4875:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5291:Bbs9 UTSW 9 22628997 missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22575196 critical splice donor site probably null
R5502:Bbs9 UTSW 9 22504074 missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5932:Bbs9 UTSW 9 22812331 missense probably damaging 1.00
R6222:Bbs9 UTSW 9 22567851 missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22567764 missense probably damaging 1.00
R6726:Bbs9 UTSW 9 22645964 missense probably benign 0.00
R6745:Bbs9 UTSW 9 22670836 missense probably benign 0.00
R6908:Bbs9 UTSW 9 22567723 missense probably damaging 0.96
R6919:Bbs9 UTSW 9 22812544 critical splice donor site probably null
R7102:Bbs9 UTSW 9 22579553 missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22670800 missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22670813 missense probably benign 0.34
X0027:Bbs9 UTSW 9 22655330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTAGTGGTGGAATCTAACTG -3'
(R):5'- TGCAAGGCATGTGATTATCAACC -3'

Sequencing Primer
(F):5'- ATTGACTTGAGGCTGATACAGAG -3'
(R):5'- GGCATGTGATTATCAACCAATTTC -3'
Posted On2018-06-06