Incidental Mutation 'R6521:Klhl18'
ID521284
Institutional Source Beutler Lab
Gene Symbol Klhl18
Ensembl Gene ENSMUSG00000054792
Gene Namekelch-like 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110425926-110476694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110428635 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 509 (I509T)
Ref Sequence ENSEMBL: ENSMUSP00000143384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068025
AA Change: I574T

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: I574T

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect possibly damaging
Transcript: ENSMUST00000198164
AA Change: I579T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: I579T

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198400
AA Change: I509T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792
AA Change: I509T

DomainStartEndE-ValueType
Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199700
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Klhl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Klhl18 APN 9 110428686 missense probably damaging 1.00
IGL01338:Klhl18 APN 9 110455433 missense probably damaging 1.00
IGL01455:Klhl18 APN 9 110432443 missense probably damaging 1.00
IGL01954:Klhl18 APN 9 110428866 missense probably damaging 1.00
IGL01960:Klhl18 APN 9 110450746 missense probably benign 0.25
IGL02195:Klhl18 APN 9 110438902 missense possibly damaging 0.92
IGL02430:Klhl18 APN 9 110437401 missense probably benign 0.25
IGL02629:Klhl18 APN 9 110429938 splice site probably benign
Mixie UTSW 9 110436062 missense probably benign 0.00
R0389:Klhl18 UTSW 9 110428681 missense probably benign 0.00
R1538:Klhl18 UTSW 9 110446747 missense probably damaging 1.00
R1777:Klhl18 UTSW 9 110437401 missense probably benign 0.25
R1966:Klhl18 UTSW 9 110476590 missense probably benign 0.14
R2099:Klhl18 UTSW 9 110455418 missense probably damaging 1.00
R3699:Klhl18 UTSW 9 110436066 missense probably benign 0.06
R3911:Klhl18 UTSW 9 110436083 missense probably damaging 1.00
R3950:Klhl18 UTSW 9 110428902 missense probably damaging 1.00
R4197:Klhl18 UTSW 9 110429944 critical splice donor site probably null
R4500:Klhl18 UTSW 9 110429966 missense probably damaging 1.00
R4936:Klhl18 UTSW 9 110428961 missense possibly damaging 0.88
R5296:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5298:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5301:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5407:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5433:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5641:Klhl18 UTSW 9 110446828 missense probably damaging 1.00
R6084:Klhl18 UTSW 9 110428727 missense possibly damaging 0.52
R6279:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6300:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6425:Klhl18 UTSW 9 110446681 missense possibly damaging 0.85
R6465:Klhl18 UTSW 9 110428920 missense probably benign 0.21
R6587:Klhl18 UTSW 9 110455426 missense probably damaging 1.00
R6730:Klhl18 UTSW 9 110428911 missense probably damaging 0.98
R7110:Klhl18 UTSW 9 110450765 missense probably damaging 0.99
R7492:Klhl18 UTSW 9 110428775 nonsense probably null
R7580:Klhl18 UTSW 9 110436050 missense probably benign 0.00
R7598:Klhl18 UTSW 9 110446810 nonsense probably null
R7789:Klhl18 UTSW 9 110439008 missense unknown
R8050:Klhl18 UTSW 9 110428761 missense probably damaging 1.00
Z1176:Klhl18 UTSW 9 110437347 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- CAACCTAAGGTCACAAGGGC -3'
(R):5'- GTGTCTCATAGTACCCATGCAC -3'

Sequencing Primer
(F):5'- CTAAGGTCACAAGGGCAGCAC -3'
(R):5'- ATGCACACACGCCGGAG -3'
Posted On2018-06-06