Incidental Mutation 'R6521:Ano4'
ID521290
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88983778 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 537 (V537A)
Ref Sequence ENSEMBL: ENSMUSP00000138325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182341] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790]
Predicted Effect probably damaging
Transcript: ENSMUST00000182341
AA Change: V572A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: V572A

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect unknown
Transcript: ENSMUST00000182598
AA Change: V87A
Predicted Effect probably damaging
Transcript: ENSMUST00000182613
AA Change: V537A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: V537A

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182790
AA Change: V537A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: V537A

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
PIT4486001:Ano4 UTSW 10 88993029 missense probably damaging 1.00
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R0540:Ano4 UTSW 10 89023944 missense probably benign 0.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4429:Ano4 UTSW 10 88992942 missense probably damaging 0.99
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4640:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5104:Ano4 UTSW 10 89068112 missense possibly damaging 0.61
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R5826:Ano4 UTSW 10 88952327 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6739:Ano4 UTSW 10 89027252 missense probably damaging 1.00
R6786:Ano4 UTSW 10 88992870 splice site probably null
R7035:Ano4 UTSW 10 88954711 missense probably damaging 1.00
R7523:Ano4 UTSW 10 88971395 nonsense probably null
R7715:Ano4 UTSW 10 88995311 missense probably damaging 0.99
R8005:Ano4 UTSW 10 88971321 missense probably benign 0.04
R8024:Ano4 UTSW 10 88971332 missense probably damaging 1.00
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Z1176:Ano4 UTSW 10 89112945 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CATGTGTAATTCTCAGTAAAGAGGC -3'
(R):5'- CTAACTATTCCTGAAAGCGTCCTG -3'

Sequencing Primer
(F):5'- AGTAGCCCACTGAGTCTAACTTGTG -3'
(R):5'- AAGCGTCCTGTTGCTCAAAG -3'
Posted On2018-06-06