Incidental Mutation 'R6521:Cyfip2'
ID521292
Institutional Source Beutler Lab
Gene Symbol Cyfip2
Ensembl Gene ENSMUSG00000020340
Gene Namecytoplasmic FMR1 interacting protein 2
Synonyms1500004I01Rik, Pir121, 6430511D02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46193850-46312859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46254588 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 635 (I635N)
Ref Sequence ENSEMBL: ENSMUSP00000127586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]
Predicted Effect probably damaging
Transcript: ENSMUST00000093165
AA Change: I635N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: I635N

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 303 5.4e-12 PFAM
Pfam:FragX_IP 388 1221 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093166
AA Change: I635N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: I635N

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000142017
AA Change: I329N
SMART Domains Protein: ENSMUSP00000119801
Gene: ENSMUSG00000020340
AA Change: I329N

DomainStartEndE-ValueType
Pfam:FragX_IP 58 230 4e-66 PFAM
Pfam:FragX_IP 246 916 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165599
AA Change: I635N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: I635N

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Cyfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cyfip2 APN 11 46200685 missense possibly damaging 0.74
IGL01352:Cyfip2 APN 11 46265996 missense probably benign 0.01
IGL01685:Cyfip2 APN 11 46207488 splice site probably benign
IGL02367:Cyfip2 APN 11 46276905 nonsense probably null
IGL02390:Cyfip2 APN 11 46221398 missense possibly damaging 0.58
IGL02471:Cyfip2 APN 11 46200803 missense possibly damaging 0.58
IGL02583:Cyfip2 APN 11 46249758 missense possibly damaging 0.56
IGL03199:Cyfip2 APN 11 46276843 missense probably benign 0.07
IGL02835:Cyfip2 UTSW 11 46249771 missense probably benign 0.00
R0081:Cyfip2 UTSW 11 46253998 nonsense probably null
R0288:Cyfip2 UTSW 11 46253972 missense possibly damaging 0.94
R1830:Cyfip2 UTSW 11 46199019 missense probably damaging 1.00
R1869:Cyfip2 UTSW 11 46224168 missense probably benign 0.40
R1989:Cyfip2 UTSW 11 46253998 nonsense probably null
R2045:Cyfip2 UTSW 11 46249789 missense probably benign 0.00
R2101:Cyfip2 UTSW 11 46242443 missense probably damaging 1.00
R2131:Cyfip2 UTSW 11 46286131 missense possibly damaging 0.78
R2162:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R2299:Cyfip2 UTSW 11 46286131 missense probably benign 0.02
R3831:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3832:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3833:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3881:Cyfip2 UTSW 11 46208335 missense probably damaging 1.00
R4127:Cyfip2 UTSW 11 46270647 missense probably benign 0.00
R4385:Cyfip2 UTSW 11 46242403 missense probably benign 0.05
R4617:Cyfip2 UTSW 11 46254018 missense probably damaging 1.00
R4739:Cyfip2 UTSW 11 46279993 missense probably damaging 0.99
R5232:Cyfip2 UTSW 11 46242378 missense probably damaging 1.00
R5365:Cyfip2 UTSW 11 46247630 missense probably damaging 0.99
R5383:Cyfip2 UTSW 11 46278091 missense possibly damaging 0.83
R5447:Cyfip2 UTSW 11 46291586 missense possibly damaging 0.72
R5450:Cyfip2 UTSW 11 46284252 missense probably benign 0.00
R5796:Cyfip2 UTSW 11 46198996 missense probably benign 0.01
R5820:Cyfip2 UTSW 11 46200704 missense probably damaging 1.00
R5925:Cyfip2 UTSW 11 46207436 missense probably damaging 1.00
R6143:Cyfip2 UTSW 11 46253965 nonsense probably null
R6321:Cyfip2 UTSW 11 46291520 missense probably benign 0.01
R6502:Cyfip2 UTSW 11 46221346 missense probably damaging 1.00
R6511:Cyfip2 UTSW 11 46196308 missense probably benign 0.00
R6660:Cyfip2 UTSW 11 46249807 missense possibly damaging 0.89
R6836:Cyfip2 UTSW 11 46272640 missense probably benign 0.16
R6866:Cyfip2 UTSW 11 46242459 nonsense probably null
R7062:Cyfip2 UTSW 11 46260832 missense probably damaging 1.00
R7192:Cyfip2 UTSW 11 46254666 missense probably benign 0.21
R7231:Cyfip2 UTSW 11 46224136 missense probably benign
R7258:Cyfip2 UTSW 11 46224177 missense probably benign 0.02
R7365:Cyfip2 UTSW 11 46207440 nonsense probably null
R7441:Cyfip2 UTSW 11 46196427 missense possibly damaging 0.80
R7561:Cyfip2 UTSW 11 46270598 missense probably benign 0.00
R7831:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7871:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
Z1176:Cyfip2 UTSW 11 46222615 missense not run
Z1177:Cyfip2 UTSW 11 46222615 missense not run
Predicted Primers PCR Primer
(F):5'- GCTGAGGCAAATGACCTTGGAG -3'
(R):5'- ATCCGGGAAGGGCTGTATAC -3'

Sequencing Primer
(F):5'- GAACACTTTGCCTAATCTCTACTCAG -3'
(R):5'- GCTGTATACCTAGCAGTGACAGC -3'
Posted On2018-06-06