Incidental Mutation 'R6547:Tcaim'
ID521297
Institutional Source Beutler Lab
Gene Symbol Tcaim
Ensembl Gene ENSMUSG00000046603
Gene NameT cell activation inhibitor, mitochondrial
SynonymsLOC382117, D9Ertd402e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location122805539-122836334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122814466 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 77 (V77D)
Ref Sequence ENSEMBL: ENSMUSP00000049759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052740] [ENSMUST00000136274]
Predicted Effect probably benign
Transcript: ENSMUST00000052740
AA Change: V77D

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049759
Gene: ENSMUSG00000046603
AA Change: V77D

DomainStartEndE-ValueType
Pfam:DUF4460 33 144 4.2e-40 PFAM
Pfam:DUF4461 199 503 4.1e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136274
AA Change: V77D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120948
Gene: ENSMUSG00000046603
AA Change: V77D

DomainStartEndE-ValueType
Pfam:DUF4460 31 125 2.7e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157461
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Tcaim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Tcaim APN 9 122814562 missense possibly damaging 0.69
IGL01775:Tcaim APN 9 122818825 missense probably damaging 1.00
R1193:Tcaim UTSW 9 122818830 missense probably damaging 0.96
R1487:Tcaim UTSW 9 122818832 nonsense probably null
R1592:Tcaim UTSW 9 122818773 critical splice acceptor site probably null
R1639:Tcaim UTSW 9 122818773 critical splice acceptor site probably null
R1642:Tcaim UTSW 9 122818773 critical splice acceptor site probably null
R1853:Tcaim UTSW 9 122826206 missense probably damaging 1.00
R4204:Tcaim UTSW 9 122833618 missense probably benign 0.01
R4427:Tcaim UTSW 9 122814496 missense probably benign 0.01
R6599:Tcaim UTSW 9 122834779 nonsense probably null
R6906:Tcaim UTSW 9 122834774 missense probably benign 0.01
R7158:Tcaim UTSW 9 122818990 missense possibly damaging 0.66
R7286:Tcaim UTSW 9 122819027 critical splice donor site probably null
R7806:Tcaim UTSW 9 122834930 missense probably damaging 1.00
Z1088:Tcaim UTSW 9 122833657 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAACAAAGCAGTGTCTCACT -3'
(R):5'- TCAAGGCTCAAATCCCAAGGT -3'

Sequencing Primer
(F):5'- ACAGTGGTTTGGAACTCACC -3'
(R):5'- GGCTCAAATCCCAAGGTATTCTGG -3'
Posted On2018-06-06