Incidental Mutation 'R6521:Mtmr4'
ID521300
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Namemyotubularin related protein 4
SynonymsZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87592162-87616302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87613527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1044 (T1044A)
Ref Sequence ENSEMBL: ENSMUSP00000090478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000093956] [ENSMUST00000103179] [ENSMUST00000119628]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092802
AA Change: T1044A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: T1044A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093956
SMART Domains Protein: ENSMUSP00000091488
Gene: ENSMUSG00000070345

DomainStartEndE-ValueType
HSF 11 153 2.35e-9 SMART
Blast:HSF 163 423 1e-149 BLAST
low complexity region 442 457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103179
AA Change: T1101A

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: T1101A

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119628
AA Change: T1101A

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: T1101A

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87610967 missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87605049 nonsense probably null
R5907:Mtmr4 UTSW 11 87612050 missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87613483 missense probably damaging 1.00
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTCATAGTATTCAGGTGATGC -3'
(R):5'- CTGCAATCCGGAAAGTAGCC -3'

Sequencing Primer
(F):5'- AGACAACTATTGTGTGGCCC -3'
(R):5'- TAGCCCAAAGGAAACTGGC -3'
Posted On2018-06-06