Incidental Mutation 'R6521:Rem2'
ID521310
Institutional Source Beutler Lab
Gene Symbol Rem2
Ensembl Gene ENSMUSG00000022176
Gene Namerad and gem related GTP binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54476100-54480431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54477687 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 107 (A107V)
Ref Sequence ENSEMBL: ENSMUSP00000132998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164697] [ENSMUST00000164766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164697
AA Change: A107V

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132998
Gene: ENSMUSG00000022176
AA Change: A107V

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
SCOP:d1f6ba_ 107 135 5e-5 SMART
PDB:3Q85|B 114 149 3e-17 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000164766
AA Change: A107V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127199
Gene: ENSMUSG00000022176
AA Change: A107V

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
low complexity region 90 108 N/A INTRINSIC
Pfam:Roc 117 234 3e-11 PFAM
Pfam:Ras 117 280 4.8e-31 PFAM
low complexity region 292 303 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168930
AA Change: A72V
SMART Domains Protein: ENSMUSP00000131989
Gene: ENSMUSG00000022176
AA Change: A72V

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 56 74 N/A INTRINSIC
Pfam:Ras 83 140 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170337
Meta Mutation Damage Score 0.0780 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Rem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03158:Rem2 APN 14 54478958 missense probably benign 0.01
R0110:Rem2 UTSW 14 54476297 unclassified probably benign
R0450:Rem2 UTSW 14 54476297 unclassified probably benign
R0510:Rem2 UTSW 14 54476297 unclassified probably benign
R1562:Rem2 UTSW 14 54476318 missense probably benign 0.00
R1673:Rem2 UTSW 14 54476309 unclassified probably benign
R1718:Rem2 UTSW 14 54479150 missense probably damaging 1.00
R2878:Rem2 UTSW 14 54476362 missense possibly damaging 0.92
R4569:Rem2 UTSW 14 54477659 missense probably damaging 1.00
R4570:Rem2 UTSW 14 54477659 missense probably damaging 1.00
R4571:Rem2 UTSW 14 54477659 missense probably damaging 1.00
R6045:Rem2 UTSW 14 54477768 missense probably damaging 1.00
R7042:Rem2 UTSW 14 54478091 missense probably damaging 1.00
R7861:Rem2 UTSW 14 54477799 missense probably damaging 1.00
Z1177:Rem2 UTSW 14 54479581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTCATCCGATGTCTAG -3'
(R):5'- TTCATGCCTGACTAGAGCCC -3'

Sequencing Primer
(F):5'- ATGTCTAGATATATCTCACCCATGGC -3'
(R):5'- CCTGACTAGAGCCCTCCAG -3'
Posted On2018-06-06