Incidental Mutation 'R6547:Nploc4'
ID521313
Institutional Source Beutler Lab
Gene Symbol Nploc4
Ensembl Gene ENSMUSG00000039703
Gene NameNPL4 homolog, ubiquitin recognition factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120380370-120437708 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 120428522 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044271] [ENSMUST00000103017]
Predicted Effect probably null
Transcript: ENSMUST00000044271
SMART Domains Protein: ENSMUSP00000035851
Gene: ENSMUSG00000039703

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 1.1e-36 PFAM
Pfam:zf-NPL4 105 245 2.1e-64 PFAM
Pfam:NPL4 248 557 4.8e-129 PFAM
ZnF_RBZ 582 606 8.4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103017
SMART Domains Protein: ENSMUSP00000099306
Gene: ENSMUSG00000039703

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 7e-38 PFAM
Pfam:zf-NPL4 104 246 1.1e-61 PFAM
Pfam:NPL4 248 455 1.8e-87 PFAM
Pfam:NPL4 451 525 3e-15 PFAM
ZnF_RBZ 550 574 8.4e-4 SMART
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Nploc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Nploc4 APN 11 120389372 missense probably benign 0.06
IGL03373:Nploc4 APN 11 120409629 nonsense probably null
P0041:Nploc4 UTSW 11 120418331 missense probably damaging 1.00
R0200:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R0608:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R1401:Nploc4 UTSW 11 120383289 splice site probably benign
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1722:Nploc4 UTSW 11 120382569 missense probably benign 0.02
R1919:Nploc4 UTSW 11 120404229 missense probably damaging 1.00
R2436:Nploc4 UTSW 11 120418317 missense possibly damaging 0.79
R4603:Nploc4 UTSW 11 120385787 missense probably benign 0.00
R4771:Nploc4 UTSW 11 120421434 missense possibly damaging 0.47
R5179:Nploc4 UTSW 11 120408856 missense probably benign 0.02
R5361:Nploc4 UTSW 11 120384563 missense probably damaging 1.00
R5414:Nploc4 UTSW 11 120413643 missense probably damaging 0.99
R5567:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R5570:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R6259:Nploc4 UTSW 11 120385865 missense probably benign 0.01
R6683:Nploc4 UTSW 11 120383330 missense probably damaging 0.98
R7134:Nploc4 UTSW 11 120385788 missense probably benign 0.02
R7256:Nploc4 UTSW 11 120428550 missense probably benign
R7284:Nploc4 UTSW 11 120416370 missense possibly damaging 0.89
R7386:Nploc4 UTSW 11 120408881 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTCAACAGTAACTGCTGGCC -3'
(R):5'- GAGCATTTCCTAACGTTACCAAGTG -3'

Sequencing Primer
(F):5'- AGTGAGCAAGGCCTTAGT -3'
(R):5'- ACCAAGTGTTCTTCCTGTGG -3'
Posted On2018-06-06