Incidental Mutation 'R6521:Serhl'
ID521314
Institutional Source Beutler Lab
Gene Symbol Serhl
Ensembl Gene ENSMUSG00000058586
Gene Nameserine hydrolase-like
Synonyms1110019M09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83089506-83116674 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 83101642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078218] [ENSMUST00000078218] [ENSMUST00000078218] [ENSMUST00000166427] [ENSMUST00000167389] [ENSMUST00000167862] [ENSMUST00000167862] [ENSMUST00000167862] [ENSMUST00000168029] [ENSMUST00000168029] [ENSMUST00000168029]
Predicted Effect probably null
Transcript: ENSMUST00000078218
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078218
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078218
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165371
Predicted Effect silent
Transcript: ENSMUST00000166427
SMART Domains Protein: ENSMUSP00000132686
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Hydrolase_4 33 194 7.4e-11 PFAM
Pfam:Abhydrolase_1 37 299 4e-20 PFAM
Pfam:Abhydrolase_5 38 292 4.4e-10 PFAM
Pfam:Abhydrolase_6 39 305 6.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167389
SMART Domains Protein: ENSMUSP00000128251
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 54 4.3e-8 PFAM
Pfam:Abhydrolase_1 3 54 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167750
Predicted Effect probably null
Transcript: ENSMUST00000167862
Predicted Effect probably null
Transcript: ENSMUST00000167862
Predicted Effect probably null
Transcript: ENSMUST00000167862
Predicted Effect probably null
Transcript: ENSMUST00000168029
SMART Domains Protein: ENSMUSP00000128802
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 1 96 3.3e-15 PFAM
Pfam:Abhydrolase_6 1 97 2.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168029
SMART Domains Protein: ENSMUSP00000128802
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 1 96 3.3e-15 PFAM
Pfam:Abhydrolase_6 1 97 2.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168029
SMART Domains Protein: ENSMUSP00000128802
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 1 96 3.3e-15 PFAM
Pfam:Abhydrolase_6 1 97 2.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169702
Predicted Effect probably benign
Transcript: ENSMUST00000169814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172101
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Serhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Serhl APN 15 83104373 missense probably benign 0.15
IGL00425:Serhl APN 15 83105637 missense possibly damaging 0.79
R1544:Serhl UTSW 15 83105676 missense probably damaging 1.00
R2119:Serhl UTSW 15 83115575 missense probably benign 0.19
R2320:Serhl UTSW 15 83101872 missense probably damaging 0.99
R3236:Serhl UTSW 15 83104403 missense probably damaging 0.96
R5156:Serhl UTSW 15 83102694 unclassified probably benign
R5256:Serhl UTSW 15 83102634 missense probably damaging 1.00
R5822:Serhl UTSW 15 83116327 missense probably benign 0.02
R5951:Serhl UTSW 15 83103036 unclassified probably benign
R6385:Serhl UTSW 15 83101622 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGATCTTTCTCATCCAGGGG -3'
(R):5'- TCCATAGCCATGTAACAGAAGTC -3'

Sequencing Primer
(F):5'- GGGACCCAAGCTGTCTTTC -3'
(R):5'- CAGAAGTCTGCAGCAGGG -3'
Posted On2018-06-06