Mutagenetix > Incidental Mutation

Incidental Mutation 'R6547:Vmn2r111'

521321

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

044672-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R6547 (G1)

Quality Score

217.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,659,907		probably benign	Het
9230113P08Rik	T	A	9: 35,908,485	M15K	probably null	Het
Abca13	T	A	11: 9,274,757	V490E	probably benign	Het
Abca2	G	T	2: 25,433,338	G106V	possibly damaging	Het
Ablim3	T	C	18: 61,823,929	T276A	probably benign	Het
Anxa7	A	G	14: 20,469,393	V119A	probably benign	Het
Arl9	A	G	5: 77,010,410		probably null	Het
Atm	T	C	9: 53,440,157	Y2964C	probably damaging	Het
Bbs9	T	C	9: 22,514,069	Y140H	probably benign	Het
Calcr	A	T	6: 3,717,177	D94E	probably damaging	Het
Celsr3	T	A	9: 108,829,128	Y937N	probably damaging	Het
Clca3a1	C	T	3: 144,736,947	A779T	probably damaging	Het
Clec9a	T	A	6: 129,416,376	V94D	probably benign	Het
Colec12	G	T	18: 9,840,351	L57F	probably damaging	Het
Fa2h	T	C	8: 111,348,020	Y317C	probably damaging	Het
Fam126a	T	C	5: 23,965,100	N417S	probably benign	Het
Flnc	A	G	6: 29,448,608	T1282A	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Hcn2	G	T	10: 79,717,152	V162L	probably benign	Het
Kbtbd11	T	A	8: 15,027,641	V80E	possibly damaging	Het
Lama4	A	G	10: 39,073,656	D915G	probably damaging	Het
Limch1	A	T	5: 67,028,774	E806V	probably damaging	Het
Mppe1	T	C	18: 67,228,988	I169V	probably benign	Het
Msc	A	C	1: 14,755,745	S2A	possibly damaging	Het
Nploc4	A	G	11: 120,428,522		probably null	Het
Nr3c2	A	T	8: 76,908,809	I180F	possibly damaging	Het
Nrap	G	T	19: 56,351,566	H840N	probably benign	Het
Olfr151	T	A	9: 37,730,495	M163L	probably benign	Het
Pdlim1	G	A	19: 40,223,120	T243I	probably damaging	Het
Pfkl	T	A	10: 77,995,354	M318L	probably benign	Het
Rap1gds1	C	A	3: 138,955,338	R426L	probably damaging	Het
Ric1	A	G	19: 29,594,826	N674D	probably damaging	Het
Rp1	G	A	1: 4,170,305	T875I	unknown	Het
Rtn1	G	T	12: 72,308,761	S137Y	possibly damaging	Het
Scn2a	A	G	2: 65,715,897	I935V	probably benign	Het
Serpina1a	C	T	12: 103,855,921	V251M	probably damaging	Het
Slc19a3	A	G	1: 83,022,900	V132A	probably damaging	Het
Slc26a6	T	A	9: 108,860,782		probably null	Het
Slc2a5	T	A	4: 150,135,619	V164D	possibly damaging	Het
Slc4a1	T	A	11: 102,356,735	T441S	probably damaging	Het
Stk33	T	C	7: 109,320,835	I366V	possibly damaging	Het
Syt14	G	T	1: 192,901,869	H696N	possibly damaging	Het
Tcaim	T	A	9: 122,814,466	V77D	probably benign	Het
Tefm	T	G	11: 80,140,384		probably null	Het
Tekt3	T	A	11: 63,070,478	S158T	possibly damaging	Het
Tmem2	A	T	19: 21,844,831	T1197S	probably benign	Het
Tspan11	T	A	6: 127,949,803	M238K	possibly damaging	Het
Unc5c	A	T	3: 141,790,019	T476S	probably benign	Het
Usp9y	A	T	Y: 1,444,612	L109Q	probably damaging	Homo
Vps13c	C	A	9: 67,973,365	Q3495K	probably damaging	Het
Zbtb10	G	A	3: 9,251,703	A192T	probably benign	Het
Zfp316	A	T	5: 143,254,197	V689D	probably damaging	Het
Zswim1	A	G	2: 164,824,796		probably benign	Het
Zswim5	T	C	4: 116,986,903	L1046P	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22,548,753 (GRCm38)	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22,568,984 (GRCm38)	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22,569,016 (GRCm38)	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22,571,985 (GRCm38)	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22,548,737 (GRCm38)	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22,548,572 (GRCm38)	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22,571,392 (GRCm38)	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22,569,073 (GRCm38)	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22,548,284 (GRCm38)	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22,570,773 (GRCm38)	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22,568,856 (GRCm38)	missense	probably benign
IGL02519:Vmn2r111	APN	17	22,548,339 (GRCm38)	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22,571,050 (GRCm38)	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22,573,224 (GRCm38)	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22,559,042 (GRCm38)	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22,571,245 (GRCm38)	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22,570,858 (GRCm38)	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22,548,009 (GRCm38)	missense	probably benign
R0064:Vmn2r111	UTSW	17	22,572,072 (GRCm38)	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22,573,121 (GRCm38)	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22,571,116 (GRCm38)	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22,571,047 (GRCm38)	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22,571,047 (GRCm38)	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22,571,399 (GRCm38)	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22,569,061 (GRCm38)	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22,569,061 (GRCm38)	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22,548,060 (GRCm38)	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22,548,081 (GRCm38)	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22,548,414 (GRCm38)	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22,559,062 (GRCm38)	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22,573,104 (GRCm38)	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22,559,170 (GRCm38)	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22,571,161 (GRCm38)	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22,571,320 (GRCm38)	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22,559,115 (GRCm38)	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22,573,178 (GRCm38)	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22,548,656 (GRCm38)	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22,548,041 (GRCm38)	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22,571,143 (GRCm38)	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22,571,020 (GRCm38)	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22,548,102 (GRCm38)	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22,573,271 (GRCm38)	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22,548,489 (GRCm38)	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22,548,257 (GRCm38)	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6149:Vmn2r111	UTSW	17	22,548,815 (GRCm38)	missense	probably benign	0.00
R6207:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22,573,089 (GRCm38)	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22,571,908 (GRCm38)	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22,548,602 (GRCm38)	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22,571,245 (GRCm38)	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22,548,184 (GRCm38)	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22,548,714 (GRCm38)	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22,571,086 (GRCm38)	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22,548,399 (GRCm38)	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22,570,733 (GRCm38)	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22,573,102 (GRCm38)	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22,571,488 (GRCm38)	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22,573,092 (GRCm38)	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22,559,051 (GRCm38)	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22,548,581 (GRCm38)	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22,571,293 (GRCm38)	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22,559,043 (GRCm38)	missense	probably damaging	1.00
R8540:Vmn2r111	UTSW	17	22,559,042 (GRCm38)	critical splice donor site	probably null
R8557:Vmn2r111	UTSW	17	22,571,929 (GRCm38)	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22,573,213 (GRCm38)	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22,548,258 (GRCm38)	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22,548,030 (GRCm38)	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22,571,841 (GRCm38)	missense	probably benign
R9374:Vmn2r111	UTSW	17	22,568,878 (GRCm38)	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22,559,151 (GRCm38)	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22,548,695 (GRCm38)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2018-06-06