Incidental Mutation 'R6521:Pigx'
ID521322
Institutional Source Beutler Lab
Gene Symbol Pigx
Ensembl Gene ENSMUSG00000023791
Gene Namephosphatidylinositol glycan anchor biosynthesis, class X
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32084416-32099740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32087311 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 64 (L64P)
Ref Sequence ENSEMBL: ENSMUSP00000156144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096109] [ENSMUST00000133584] [ENSMUST00000136643] [ENSMUST00000147003] [ENSMUST00000147688] [ENSMUST00000155966] [ENSMUST00000189013] [ENSMUST00000215073] [ENSMUST00000232321]
Predicted Effect probably damaging
Transcript: ENSMUST00000096109
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093819
Gene: ENSMUSG00000023791
AA Change: L168P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PIG-X 49 249 3.24e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133584
SMART Domains Protein: ENSMUSP00000119754
Gene: ENSMUSG00000023791

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136643
SMART Domains Protein: ENSMUSP00000118256
Gene: ENSMUSG00000023791

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143011
Predicted Effect probably benign
Transcript: ENSMUST00000147003
SMART Domains Protein: ENSMUSP00000120272
Gene: ENSMUSG00000023791

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147688
SMART Domains Protein: ENSMUSP00000121801
Gene: ENSMUSG00000023791

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PIG-X 49 105 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151250
Predicted Effect probably damaging
Transcript: ENSMUST00000155966
AA Change: L166P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114854
Gene: ENSMUSG00000023791
AA Change: L166P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PIG-X 47 247 3.24e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189013
AA Change: L166P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141122
Gene: ENSMUSG00000023791
AA Change: L166P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PIG-X 47 247 3.24e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215073
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232321
AA Change: L64P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Pigx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Pigx APN 16 32084610 missense probably benign 0.43
IGL02662:Pigx APN 16 32087383 missense probably damaging 0.99
F5770:Pigx UTSW 16 32087422 missense probably damaging 1.00
R1682:Pigx UTSW 16 32087450 missense possibly damaging 0.91
R6195:Pigx UTSW 16 32084586 missense probably damaging 0.99
R6379:Pigx UTSW 16 32084523 missense probably damaging 1.00
V7580:Pigx UTSW 16 32087422 missense probably damaging 1.00
V7583:Pigx UTSW 16 32087422 missense probably damaging 1.00
Z1176:Pigx UTSW 16 32087425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTATTTGCCTTACAACAATCCCCTAC -3'
(R):5'- GTTTTCTCTCCCACAGGCAG -3'

Sequencing Primer
(F):5'- AACAATCCCCTACATCGTGTGTG -3'
(R):5'- ACAGGCAGTGATGCTATCAG -3'
Posted On2018-06-06