Mutagenetix > Incidental Mutations

Incidental Mutation 'R6547:Ric1'

521331

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.466) question?

Stock #

R6547 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29594826 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 674 (N674D)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043610
AA Change: N674D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: N674D

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160452

SMART Domains

Protein: ENSMUSP00000125299
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
Pfam:RIC1	8	163	1.4e-60	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161330

SMART Domains

Protein: ENSMUSP00000125709
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
low complexity region	7	28	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161536

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: N565D

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: N565D

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.4641

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,659,907		probably benign	Het
9230113P08Rik	T	A	9: 35,908,485	M15K	probably null	Het
Abca13	T	A	11: 9,274,757	V490E	probably benign	Het
Abca2	G	T	2: 25,433,338	G106V	possibly damaging	Het
Ablim3	T	C	18: 61,823,929	T276A	probably benign	Het
Anxa7	A	G	14: 20,469,393	V119A	probably benign	Het
Arl9	A	G	5: 77,010,410		probably null	Het
Atm	T	C	9: 53,440,157	Y2964C	probably damaging	Het
Bbs9	T	C	9: 22,514,069	Y140H	probably benign	Het
Calcr	A	T	6: 3,717,177	D94E	probably damaging	Het
Celsr3	T	A	9: 108,829,128	Y937N	probably damaging	Het
Clca3a1	C	T	3: 144,736,947	A779T	probably damaging	Het
Clec9a	T	A	6: 129,416,376	V94D	probably benign	Het
Colec12	G	T	18: 9,840,351	L57F	probably damaging	Het
Fa2h	T	C	8: 111,348,020	Y317C	probably damaging	Het
Fam126a	T	C	5: 23,965,100	N417S	probably benign	Het
Flnc	A	G	6: 29,448,608	T1282A	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Hcn2	G	T	10: 79,717,152	V162L	probably benign	Het
Kbtbd11	T	A	8: 15,027,641	V80E	possibly damaging	Het
Lama4	A	G	10: 39,073,656	D915G	probably damaging	Het
Limch1	A	T	5: 67,028,774	E806V	probably damaging	Het
Mppe1	T	C	18: 67,228,988	I169V	probably benign	Het
Msc	A	C	1: 14,755,745	S2A	possibly damaging	Het
Nploc4	A	G	11: 120,428,522		probably null	Het
Nr3c2	A	T	8: 76,908,809	I180F	possibly damaging	Het
Nrap	G	T	19: 56,351,566	H840N	probably benign	Het
Olfr151	T	A	9: 37,730,495	M163L	probably benign	Het
Pdlim1	G	A	19: 40,223,120	T243I	probably damaging	Het
Pfkl	T	A	10: 77,995,354	M318L	probably benign	Het
Rap1gds1	C	A	3: 138,955,338	R426L	probably damaging	Het
Rp1	G	A	1: 4,170,305	T875I	unknown	Het
Rtn1	G	T	12: 72,308,761	S137Y	possibly damaging	Het
Scn2a	A	G	2: 65,715,897	I935V	probably benign	Het
Serpina1a	C	T	12: 103,855,921	V251M	probably damaging	Het
Slc19a3	A	G	1: 83,022,900	V132A	probably damaging	Het
Slc26a6	T	A	9: 108,860,782		probably null	Het
Slc2a5	T	A	4: 150,135,619	V164D	possibly damaging	Het
Slc4a1	T	A	11: 102,356,735	T441S	probably damaging	Het
Stk33	T	C	7: 109,320,835	I366V	possibly damaging	Het
Syt14	G	T	1: 192,901,869	H696N	possibly damaging	Het
Tcaim	T	A	9: 122,814,466	V77D	probably benign	Het
Tefm	T	G	11: 80,140,384		probably null	Het
Tekt3	T	A	11: 63,070,478	S158T	possibly damaging	Het
Tmem2	A	T	19: 21,844,831	T1197S	probably benign	Het
Tspan11	T	A	6: 127,949,803	M238K	possibly damaging	Het
Unc5c	A	T	3: 141,790,019	T476S	probably benign	Het
Usp9y	A	T	Y: 1,444,612	L109Q	probably damaging	Homo
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vps13c	C	A	9: 67,973,365	Q3495K	probably damaging	Het
Zbtb10	G	A	3: 9,251,703	A192T	probably benign	Het
Zfp316	A	T	5: 143,254,197	V689D	probably damaging	Het
Zswim1	A	G	2: 164,824,796		probably benign	Het
Zswim5	T	C	4: 116,986,903	L1046P	probably damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTGTCTATCTTGTCCAGGAAAC -3'
(R):5'- ATGTTCTTGGTGCCTAAGTCAC -3'

Sequencing Primer
(F):5'- GAAACTTGTTTTCCCACAGAGCCTAG -3'
(R):5'- GTTCTTGGTGCCTAAGTCACAACAC -3'

Posted On

2018-06-06