Incidental Mutation 'R6547:Pdlim1'
ID521333
Institutional Source Beutler Lab
Gene Symbol Pdlim1
Ensembl Gene ENSMUSG00000055044
Gene NamePDZ and LIM domain 1 (elfin)
SynonymsCLP36, mClim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6547 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40221173-40271842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40223120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 243 (T243I)
Ref Sequence ENSEMBL: ENSMUSP00000064545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068439]
Predicted Effect probably damaging
Transcript: ENSMUST00000068439
AA Change: T243I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: T243I

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Pfam:DUF4749 136 234 4.6e-29 PFAM
LIM 257 308 2.31e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182813
Meta Mutation Damage Score 0.4489 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Pdlim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Pdlim1 APN 19 40243466 missense probably benign 0.00
IGL02253:Pdlim1 APN 19 40230530 missense probably damaging 0.99
IGL02312:Pdlim1 APN 19 40223061 missense probably benign 0.00
IGL02584:Pdlim1 APN 19 40243400 splice site probably null
R0391:Pdlim1 UTSW 19 40243573 missense probably damaging 0.99
R1554:Pdlim1 UTSW 19 40223072 missense probably benign 0.19
R1751:Pdlim1 UTSW 19 40251904 splice site probably benign
R1972:Pdlim1 UTSW 19 40223137 missense probably damaging 0.99
R2900:Pdlim1 UTSW 19 40223075 missense probably damaging 1.00
R4709:Pdlim1 UTSW 19 40222736 missense probably benign 0.26
R4803:Pdlim1 UTSW 19 40243448 missense possibly damaging 0.94
R4818:Pdlim1 UTSW 19 40223136 missense probably damaging 0.98
R5360:Pdlim1 UTSW 19 40230549 missense probably damaging 0.99
R5833:Pdlim1 UTSW 19 40230545 missense probably damaging 1.00
R7699:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7700:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7756:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7758:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTGAATGGGAAGACTCGTC -3'
(R):5'- GCAGATCCTGATAGCAGTGTC -3'

Sequencing Primer
(F):5'- TGGGAAGACTCGTCATTCTAAAAGC -3'
(R):5'- CAGATCCTGATAGCAGTGTCTTGAC -3'
Posted On2018-06-06