Incidental Mutation 'R6547:Usp9y'
ID521337
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Nameubiquitin specific peptidase 9, Y chromosome
SynonymsDffry, Fafl2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6547 (G1)
Quality Score222.003
Status Validated
ChromosomeY
Chromosomal Location1298961-1459782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 1444612 bp
ZygosityHomozygous
Amino Acid Change Leucine to Glutamine at position 109 (L109Q)
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
Predicted Effect probably damaging
Transcript: ENSMUST00000091188
AA Change: L109Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044
AA Change: L109Q

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Kbtbd11 T A 8: 15,027,641 V80E possibly damaging Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1432197 missense probably damaging 0.96
R0288:Usp9y UTSW Y 1333606 splice site probably benign
R0365:Usp9y UTSW Y 1364732 missense probably damaging 1.00
R0386:Usp9y UTSW Y 1316933 missense probably damaging 1.00
R0395:Usp9y UTSW Y 1340053 missense probably damaging 1.00
R0518:Usp9y UTSW Y 1307880 missense probably benign
R0521:Usp9y UTSW Y 1307880 missense probably benign
R0530:Usp9y UTSW Y 1333600 splice site probably benign
R0759:Usp9y UTSW Y 1299097 missense probably damaging 0.99
R0849:Usp9y UTSW Y 1394002 missense probably damaging 1.00
R0932:Usp9y UTSW Y 1315930 missense probably benign 0.37
R1018:Usp9y UTSW Y 1341414 splice site probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1730:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1743:Usp9y UTSW Y 1316727 missense probably damaging 1.00
R1765:Usp9y UTSW Y 1384454 missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1368089 missense probably damaging 1.00
R1783:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1889:Usp9y UTSW Y 1448829 intron probably null
R1901:Usp9y UTSW Y 1303371 critical splice donor site probably null
R2081:Usp9y UTSW Y 1381277 missense possibly damaging 0.65
R2119:Usp9y UTSW Y 1303451 missense probably benign 0.00
R2357:Usp9y UTSW Y 1394050 missense possibly damaging 0.87
R2873:Usp9y UTSW Y 1310502 splice site probably benign
R3938:Usp9y UTSW Y 1313741 missense probably damaging 0.97
R4323:Usp9y UTSW Y 1434407 missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1304756 missense probably damaging 1.00
R4407:Usp9y UTSW Y 1336375 missense probably benign 0.16
R4457:Usp9y UTSW Y 1394078 missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1391284 missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1444559 missense probably damaging 0.99
R4834:Usp9y UTSW Y 1317002 missense probably benign 0.32
R4872:Usp9y UTSW Y 1307920 missense probably damaging 1.00
R4911:Usp9y UTSW Y 1308041 missense probably damaging 0.96
R4915:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R4962:Usp9y UTSW Y 1384336 missense probably damaging 1.00
R5378:Usp9y UTSW Y 1315928 missense probably damaging 0.99
R5422:Usp9y UTSW Y 1314676 missense probably benign
R5432:Usp9y UTSW Y 1368022 splice site probably null
R5442:Usp9y UTSW Y 1336467 missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1364714 missense probably benign 0.01
R5500:Usp9y UTSW Y 1341875 missense probably damaging 1.00
R5729:Usp9y UTSW Y 1381339 missense probably damaging 0.97
R5891:Usp9y UTSW Y 1341535 missense probably benign 0.05
R5920:Usp9y UTSW Y 1316730 missense probably damaging 1.00
R5948:Usp9y UTSW Y 1324996 missense possibly damaging 0.79
R6062:Usp9y UTSW Y 1454199 missense probably benign 0.28
R6265:Usp9y UTSW Y 1446843 missense probably benign 0.00
R6274:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R6313:Usp9y UTSW Y 1385355 missense probably benign
R6330:Usp9y UTSW Y 1340123 missense probably benign 0.20
R6471:Usp9y UTSW Y 1384511 missense probably damaging 1.00
R6791:Usp9y UTSW Y 1325042 splice site probably null
R7194:Usp9y UTSW Y 1304672 missense probably damaging 1.00
R7357:Usp9y UTSW Y 1333656 missense possibly damaging 0.58
R7374:Usp9y UTSW Y 1381305 missense probably benign 0.00
R7404:Usp9y UTSW Y 1341780 missense probably benign 0.35
R7481:Usp9y UTSW Y 1432180 missense probably benign 0.08
R7584:Usp9y UTSW Y 1384451 missense probably damaging 1.00
R7697:Usp9y UTSW Y 1316990 missense possibly damaging 0.72
R7713:Usp9y UTSW Y 1304411 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGAACTGGACTGCTGGT -3'
(R):5'- AGGCCATCCTCTGCTACATATAC -3'

Sequencing Primer
(F):5'- CTGGACTGCTGGTATTCTGACAAAC -3'
(R):5'- CTCTGCTACATATACAGCTGGAG -3'
Posted On2018-06-06